EMAIL THIS PAGE TO A FRIEND

FGF16

fibroblast growth factor 16

58 Gene Product Result for
Synonyms: FGF-16
UniProtKB ID: O43320
Gene ID:
Human(8823) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The rat homolog is predominantly expressed in embryonic brown adipose tissue and has significant mitogenic activity, which suggests a role in proliferation of embryonic brown adipose tissue. [provided by RefSeq, Jul 2008]
Mouse(80903) fibroblast growth factor 16
Rat(60464) fibroblast growth factor 16
sheep(101104968) fibroblast growth factor 16
naked mole-rat(101716030) fibroblast growth factor 16
domestic guinea pig(100723648) fibroblast growth factor 16
Zebrafish(692065) fibroblast growth factor 16
dog(491974) fibroblast growth factor 16
cow(540758) fibroblast growth factor 16
domestic cat(101084778) fibroblast growth factor 16
chicken(422330) fibroblast growth factor 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301558 ANTI-FGF16 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB4301081 Anti-FGF16 antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003868 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU160611 MISSION® esiRNA esiRNA targeting mouse Fgf16 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003868 Rosetta Predictions human pricing
NM_021867 Rosetta Predictions rat pricing
NM_030614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206732 predicted 265
2 SASI_Hs01_00206733 predicted 357
3 SASI_Hs01_00206734 predicted 258
4 SASI_Hs01_00206735 predicted 337
5 SASI_Hs01_00206736 predicted 396
6 SASI_Hs01_00206737 predicted 325
7 SASI_Hs01_00206738 predicted 266
8 SASI_Hs01_00206739 predicted 256
9 SASI_Hs01_00206740 predicted 372
10 SASI_Hs01_00206741 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262892 predicted 200
2 SASI_Rn02_00262893 predicted 257
3 SASI_Rn01_00121357 predicted 372
4 SASI_Rn02_00262894 predicted 354
5 SASI_Rn02_00262895 predicted 265
6 SASI_Rn02_00262896 predicted 355
7 SASI_Rn01_00121362 predicted 329
8 SASI_Rn02_00262897 predicted 323
9 SASI_Rn02_00262898 predicted 203
10 SASI_Rn02_00262899 predicted 333
11 SASI_Rn01_00121355 predicted 789
12 SASI_Rn01_00121356 predicted 1016
13 SASI_Rn01_00121358 predicted 989
14 SASI_Rn01_00121359 predicted 1184
15 SASI_Rn01_00121360 predicted 1100
16 SASI_Rn01_00121361 predicted 1256
17 SASI_Rn01_00121363 predicted 1255
18 SASI_Rn01_00121364 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164147 predicted 577
2 SASI_Mm02_00336809 predicted 662
3 SASI_Mm02_00336810 predicted 941
4 SASI_Mm02_00336811 predicted 770
5 SASI_Mm02_00336812 predicted 800
6 SASI_Mm02_00336813 predicted 1037
7 SASI_Mm02_00336814 predicted 537
8 SASI_Mm02_00336815 predicted 385
9 SASI_Mm02_00336816 predicted 420
10 SASI_Mm02_00336817 predicted 439
11 SASI_Mm01_00164141 predicted 202
12 SASI_Mm01_00164142 predicted 198
13 SASI_Mm01_00164143 predicted 211
14 SASI_Mm01_00164144 predicted 212
15 SASI_Mm01_00164145 predicted 212
16 SASI_Mm01_00164146 predicted 340
17 SASI_Mm01_00164148 predicted 375
18 SASI_Mm01_00164149 predicted 568
19 SASI_Mm01_00164150 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030614
FGF16 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-466s1c1
Sequence:CCGGGACTCGGAGAGACAGTATTATCTCGAGATAATACTGTCTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-280s1c1
Sequence:CCGGCTGGAATTTATCAGCTTGGCTCTCGAGAGCCAAGCTGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-474s1c1
Sequence:CCGGGAGACAGTATTATGTGGCCCTCTCGAGAGGGCCACATAATACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-150s1c1
Sequence:CCGGCACAGACTTCGCCCACCTGAACTCGAGTTCAGGTGGGCGAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-404s1c1
Sequence:CCGGTCCGGGAACAGTTTGAAGAAACTCGAGTTTCTTCAAACTGTTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030614
FGF16 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-466s1c1
Sequence:CCGGGACTCGGAGAGACAGTATTATCTCGAGATAATACTGTCTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-280s1c1
Sequence:CCGGCTGGAATTTATCAGCTTGGCTCTCGAGAGCCAAGCTGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-474s1c1
Sequence:CCGGGAGACAGTATTATGTGGCCCTCTCGAGAGGGCCACATAATACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-150s1c1
Sequence:CCGGCACAGACTTCGCCCACCTGAACTCGAGTTCAGGTGGGCGAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-404s1c1
Sequence:CCGGTCCGGGAACAGTTTGAAGAAACTCGAGTTTCTTCAAACTGTTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030614
FGF16 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-466s1c1
Sequence:CCGGGACTCGGAGAGACAGTATTATCTCGAGATAATACTGTCTCTCCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-280s1c1
Sequence:CCGGCTGGAATTTATCAGCTTGGCTCTCGAGAGCCAAGCTGATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-474s1c1
Sequence:CCGGGAGACAGTATTATGTGGCCCTCTCGAGAGGGCCACATAATACTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-150s1c1
Sequence:CCGGCACAGACTTCGCCCACCTGAACTCGAGTTCAGGTGGGCGAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030614.1-404s1c1
Sequence:CCGGTCCGGGAACAGTTTGAAGAAACTCGAGTTTCTTCAAACTGTTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003868
FGF16 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-269s1c1
Sequence:CCGGGCTTCGGAATCCTGGAGTTTACTCGAGTAAACTCCAGGATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-442s1c1
Sequence:CCGGGCCTCAACCTTGTACAAACATCTCGAGATGTTTGTACAAGGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-138s1c1
Sequence:CCGGGCGTGGCTCACCCACAGACTTCTCGAGAAGTCTGTGGGTGAGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-377s1c1
Sequence:CCGGCGAAGAAACTCACACGTGAATCTCGAGATTCACGTGTGAGTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-464s1c1
Sequence:CCGGCGGACTCAGAGAGACAGTATTCTCGAGAATACTGTCTCTCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-403s21c1
Sequence:CCGGTTCCGGGAACAGTTTGAAGAACTCGAGTTCTTCAAACTGTTCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-353s21c1
Sequence:CCGGATGAGCGAGGAGAACTCTATGCTCGAGCATAGAGTTCTCCTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-27s21c1
Sequence:CCGGCTCCTTGGACTGGGATCTACACTCGAGTGTAGATCCCAGTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003868
FGF16 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-269s1c1
Sequence:CCGGGCTTCGGAATCCTGGAGTTTACTCGAGTAAACTCCAGGATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-442s1c1
Sequence:CCGGGCCTCAACCTTGTACAAACATCTCGAGATGTTTGTACAAGGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-138s1c1
Sequence:CCGGGCGTGGCTCACCCACAGACTTCTCGAGAAGTCTGTGGGTGAGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-377s1c1
Sequence:CCGGCGAAGAAACTCACACGTGAATCTCGAGATTCACGTGTGAGTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-464s1c1
Sequence:CCGGCGGACTCAGAGAGACAGTATTCTCGAGAATACTGTCTCTCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-403s21c1
Sequence:CCGGTTCCGGGAACAGTTTGAAGAACTCGAGTTCTTCAAACTGTTCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-353s21c1
Sequence:CCGGATGAGCGAGGAGAACTCTATGCTCGAGCATAGAGTTCTCCTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-27s21c1
Sequence:CCGGCTCCTTGGACTGGGATCTACACTCGAGTGTAGATCCCAGTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003868
FGF16 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-269s1c1
Sequence:CCGGGCTTCGGAATCCTGGAGTTTACTCGAGTAAACTCCAGGATTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-442s1c1
Sequence:CCGGGCCTCAACCTTGTACAAACATCTCGAGATGTTTGTACAAGGTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-138s1c1
Sequence:CCGGGCGTGGCTCACCCACAGACTTCTCGAGAAGTCTGTGGGTGAGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-377s1c1
Sequence:CCGGCGAAGAAACTCACACGTGAATCTCGAGATTCACGTGTGAGTTTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003868.1-464s1c1
Sequence:CCGGCGGACTCAGAGAGACAGTATTCTCGAGAATACTGTCTCTCTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-403s21c1
Sequence:CCGGTTCCGGGAACAGTTTGAAGAACTCGAGTTCTTCAAACTGTTCCCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-353s21c1
Sequence:CCGGATGAGCGAGGAGAACTCTATGCTCGAGCATAGAGTTCTCCTCGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003868.1-27s21c1
Sequence:CCGGCTCCTTGGACTGGGATCTACACTCGAGTGTAGATCCCAGTCCAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks