EMAIL THIS PAGE TO A FRIEND

FGF17

fibroblast growth factor 17

51 Gene Product Result for
Synonyms: FGF-13 HH20
UniProtKB ID: O60258, B7ZLG4, Q2M2W1
Gene ID:
Human(8822) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was shown to be prominently expressed in the cerebellum and cortex. The mouse homolog of this gene was localized to specific sites in the midline structures of the forebrain, the midbrain-hindbrain junction, developing skeleton and developing arteries, which suggests a role in central nervous system, bone and vascular development. This gene was referred to as FGF-13 in reference 2, however, its amino acid sequence and chromosomal localization are identical to FGF17. [provided by RefSeq, Jul 2008]
Mouse(14171) fibroblast growth factor 17
Rat(29368) fibroblast growth factor 17
Zebrafish(407737) fibroblast growth factor 17
dog(607952) fibroblast growth factor 17
cow(100300257) fibroblast growth factor 17
domestic cat(101090606) fibroblast growth factor 17
domestic guinea pig(100727356) fibroblast growth factor 17
naked mole-rat(101707706) fibroblast growth factor 17
sheep(101118502) fibroblast growth factor 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003867 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003867 Rosetta Predictions human pricing
NM_019198 Rosetta Predictions rat pricing
NM_008004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123079 predicted 313
2 SASI_Hs01_00123081 predicted 964
3 SASI_Hs02_00336450 predicted 936
4 SASI_Hs01_00123082 predicted 313
5 SASI_Hs01_00123083 predicted 878
6 SASI_Hs01_00123084 predicted 950
7 SASI_Hs01_00123085 predicted 946
8 SASI_Hs01_00123086 predicted 387
9 SASI_Hs01_00123087 predicted 249
10 SASI_Hs01_00123088 predicted 251
11 SASI_Hs01_00123080 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062612 predicted 301
2 SASI_Rn01_00062614 predicted 372
3 SASI_Rn01_00062615 predicted 301
4 SASI_Rn02_00262027 predicted 273
5 SASI_Rn01_00062616 predicted 371
6 SASI_Rn01_00062617 predicted 194
7 SASI_Rn01_00062618 predicted 248
8 SASI_Rn02_00262028 predicted 429
9 SASI_Rn01_00062619 predicted 219
10 SASI_Rn01_00062620 predicted 361
11 SASI_Rn01_00062613 predicted 432
12 SASI_Rn01_00062621 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184403 predicted 759
2 SASI_Mm01_00184405 predicted 586
3 SASI_Mm01_00184406 predicted 889
4 SASI_Mm01_00184407 predicted 550
5 SASI_Mm01_00184408 predicted 1346
6 SASI_Mm02_00312934 predicted 813
7 SASI_Mm01_00184409 predicted 816
8 SASI_Mm01_00184410 predicted 734
9 SASI_Mm01_00184411 predicted 625
10 SASI_Mm01_00184412 predicted 708
11 SASI_Mm01_00184404 predicted 1087
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003867
FGF17 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-953s21c1
Sequence:CCGGCTGAAAGGTCAGCGACTGAAGCTCGAGCTTCAGTCGCTGACCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-707s21c1
Sequence:CCGGCCTTTCCCTTCTTAATCCAAGCTCGAGCTTGGATTAAGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-251s1c1
Sequence:CCGGGCAACAAGTTTGCCAAGCTCACTCGAGTGAGCTTGGCAAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-58s1c1
Sequence:CCGGCTGCTGATTCTCTGCTGTCAACTCGAGTTGACAGCAGAGAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-46s1c1
Sequence:CCGGCTGTGCTTACAGCTGCTGATTCTCGAGAATCAGCAGCTGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-170s1c1
Sequence:CCGGGCGAGTACCAACTCTACAGCACTCGAGTGCTGTAGAGTTGGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-321s1c1
Sequence:CCGGGAGTGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003867
FGF17 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-953s21c1
Sequence:CCGGCTGAAAGGTCAGCGACTGAAGCTCGAGCTTCAGTCGCTGACCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-707s21c1
Sequence:CCGGCCTTTCCCTTCTTAATCCAAGCTCGAGCTTGGATTAAGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-251s1c1
Sequence:CCGGGCAACAAGTTTGCCAAGCTCACTCGAGTGAGCTTGGCAAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-58s1c1
Sequence:CCGGCTGCTGATTCTCTGCTGTCAACTCGAGTTGACAGCAGAGAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-46s1c1
Sequence:CCGGCTGTGCTTACAGCTGCTGATTCTCGAGAATCAGCAGCTGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-170s1c1
Sequence:CCGGGCGAGTACCAACTCTACAGCACTCGAGTGCTGTAGAGTTGGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-321s1c1
Sequence:CCGGGAGTGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003867
FGF17 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-953s21c1
Sequence:CCGGCTGAAAGGTCAGCGACTGAAGCTCGAGCTTCAGTCGCTGACCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003867.2-707s21c1
Sequence:CCGGCCTTTCCCTTCTTAATCCAAGCTCGAGCTTGGATTAAGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-251s1c1
Sequence:CCGGGCAACAAGTTTGCCAAGCTCACTCGAGTGAGCTTGGCAAACTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-58s1c1
Sequence:CCGGCTGCTGATTCTCTGCTGTCAACTCGAGTTGACAGCAGAGAATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-46s1c1
Sequence:CCGGCTGTGCTTACAGCTGCTGATTCTCGAGAATCAGCAGCTGTAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-170s1c1
Sequence:CCGGGCGAGTACCAACTCTACAGCACTCGAGTGCTGTAGAGTTGGTACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003867.1-321s1c1
Sequence:CCGGGAGTGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008004
FGF17 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 17
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000067138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-546s1c1
Sequence:CCGGCCTGTGCTTGCAGCTATTGATCTCGAGATCAATAGCTGCAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-771s1c1
Sequence:CCGGCATCGTGGAGACAGATACATTCTCGAGAATGTATCTGTCTCCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-1029s1c1
Sequence:CCGGCCACTTCATCAAGCGCCTCTACTCGAGTAGAGGCGCTTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-822s1c1
Sequence:CCGGGAGCGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008004
FGF17 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 17
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000067138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-546s1c1
Sequence:CCGGCCTGTGCTTGCAGCTATTGATCTCGAGATCAATAGCTGCAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-771s1c1
Sequence:CCGGCATCGTGGAGACAGATACATTCTCGAGAATGTATCTGTCTCCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-1029s1c1
Sequence:CCGGCCACTTCATCAAGCGCCTCTACTCGAGTAGAGGCGCTTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-822s1c1
Sequence:CCGGGAGCGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008004
FGF17 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 17
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000067138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-546s1c1
Sequence:CCGGCCTGTGCTTGCAGCTATTGATCTCGAGATCAATAGCTGCAAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-771s1c1
Sequence:CCGGCATCGTGGAGACAGATACATTCTCGAGAATGTATCTGTCTCCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-1029s1c1
Sequence:CCGGCCACTTCATCAAGCGCCTCTACTCGAGTAGAGGCGCTTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008004.2-822s1c1
Sequence:CCGGGAGCGAGAAGTACATCTGTATCTCGAGATACAGATGTACTTCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks