EMAIL THIS PAGE TO A FRIEND

FGF18

fibroblast growth factor 18

Synonyms: FGF-18 ZFGF5
UniProtKB ID: O76093, D3DQL7, Q6UWF1
Gene ID:
Human(8817) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. It has been shown in vitro that this protein is able to induce neurite outgrowth in PC12 cells. Studies of the similar proteins in mouse and chick suggested that this protein is a pleiotropic growth factor that stimulates proliferation in a number of tissues, most notably the liver and small intestine. Knockout studies of the similar gene in mice implied the role of this protein in regulating proliferation and differentiation of midline cerebellar structures. [provided by RefSeq, Jul 2008]
Mouse(14172) fibroblast growth factor 18
Rat(29369) fibroblast growth factor 18
sheep(780460) fibroblast growth factor 18
naked mole-rat(101718946) fibroblast growth factor 18
domestic guinea pig(100715152) fibroblast growth factor 18
chicken(395453) fibroblast growth factor 18
domestic cat(101098518) fibroblast growth factor 18
cow(533929) fibroblast growth factor 18
dog(611641) fibroblast growth factor 18
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003862 Rosetta Predictions human pricing
NM_019199 Rosetta Predictions rat pricing
NM_008005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010631 predicted 840
2 SASI_Hs01_00010633 predicted 798
3 SASI_Hs02_00336441 predicted 948
4 SASI_Hs01_00010634 predicted 980
5 SASI_Hs01_00010635 predicted 1031
6 SASI_Hs01_00010636 predicted 793
7 SASI_Hs01_00010637 predicted 833
8 SASI_Hs01_00010638 predicted 776
9 SASI_Hs01_00010639 predicted 670
10 SASI_Hs01_00010640 predicted 670
11 SASI_Hs01_00010632 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037718 predicted 253
2 SASI_Rn01_00037719 predicted 367
3 SASI_Rn01_00037720 predicted 306
4 SASI_Rn01_00037721 predicted 309
5 SASI_Rn01_00037722 predicted 261
6 SASI_Rn01_00037723 predicted 236
7 SASI_Rn01_00037724 predicted 279
8 SASI_Rn01_00037725 predicted 355
9 SASI_Rn02_00262029 predicted 371
10 SASI_Rn01_00037726 predicted 371
11 SASI_Rn01_00037727 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044783 predicted 441
2 SASI_Mm01_00044784 predicted 386
3 SASI_Mm01_00044785 predicted 400
4 SASI_Mm01_00044786 predicted 450
5 SASI_Mm01_00044787 predicted 623
6 SASI_Mm01_00044788 predicted 557
7 SASI_Mm01_00044789 predicted 778
8 SASI_Mm01_00044790 predicted 642
9 SASI_Mm01_00044791 predicted 578
10 SASI_Mm02_00312935 predicted 544
11 SASI_Mm01_00044792 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008005
FGF18 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-453s1c1
Sequence:CCGGCTACCTGTGTATGAACCGAAACTCGAGTTTCGGTTCATACACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-565s1c1
Sequence:CCGGGCCAAGTACTCTGGTTGGTATCTCGAGATACCAACCAGAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-696s1c1
Sequence:CCGGGCCCTTCAAATACACCACAGTCTCGAGACTGTGGTGTATTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-163s1c1
Sequence:CCGGTGCCTGTGTTTACACTTTCTACTCGAGTAGAAAGTGTAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-393s1c1
Sequence:CCGGCCTAGTGGAGACAGATACCTTCTCGAGAAGGTATCTGTCTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008005
FGF18 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-453s1c1
Sequence:CCGGCTACCTGTGTATGAACCGAAACTCGAGTTTCGGTTCATACACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-565s1c1
Sequence:CCGGGCCAAGTACTCTGGTTGGTATCTCGAGATACCAACCAGAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-696s1c1
Sequence:CCGGGCCCTTCAAATACACCACAGTCTCGAGACTGTGGTGTATTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-163s1c1
Sequence:CCGGTGCCTGTGTTTACACTTTCTACTCGAGTAGAAAGTGTAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-393s1c1
Sequence:CCGGCCTAGTGGAGACAGATACCTTCTCGAGAAGGTATCTGTCTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008005
FGF18 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-453s1c1
Sequence:CCGGCTACCTGTGTATGAACCGAAACTCGAGTTTCGGTTCATACACAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-565s1c1
Sequence:CCGGGCCAAGTACTCTGGTTGGTATCTCGAGATACCAACCAGAGTACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-696s1c1
Sequence:CCGGGCCCTTCAAATACACCACAGTCTCGAGACTGTGGTGTATTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-163s1c1
Sequence:CCGGTGCCTGTGTTTACACTTTCTACTCGAGTAGAAAGTGTAAACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008005.1-393s1c1
Sequence:CCGGCCTAGTGGAGACAGATACCTTCTCGAGAAGGTATCTGTCTCCACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003862
FGF18 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1050s1c1
Sequence:CCGGCGTGCATTTCATGAAGCGCTACTCGAGTAGCGCTTCATGAAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-714s1c1
Sequence:CCGGCCGGACCAGTGGGAAACACATCTCGAGATGTGTTTCCCACTGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1098s1c1
Sequence:CCGGGCCCTTCAAGTACACGACGGTCTCGAGACCGTCGTGTACTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-906s1c1
Sequence:CCGGCAGCAAGGAGTGTGTGTTCATCTCGAGATGAACACACACTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-805s1c1
Sequence:CCGGACAGACACCTTCGGTAGTCAACTCGAGTTGACTACCGAAGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-930s21c1
Sequence:CCGGGAAGGTTCTGGAGAACAACTACTCGAGTAGTTGTTCTCCAGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-956s21c1
Sequence:CCGGCCCTGATGTCGGCTAAGTACTCTCGAGAGTACTTAGCCGACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003862.1-1369s21c1
Sequence:CCGGCTCACGCAAAGGGACTGTAGTCTCGAGACTACAGTCCCTTTGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-857s21c1
Sequence:CCGGACCTGTGCATGAACCGCAAAGCTCGAGCTTTGCGGTTCATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003862
FGF18 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1050s1c1
Sequence:CCGGCGTGCATTTCATGAAGCGCTACTCGAGTAGCGCTTCATGAAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-714s1c1
Sequence:CCGGCCGGACCAGTGGGAAACACATCTCGAGATGTGTTTCCCACTGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1098s1c1
Sequence:CCGGGCCCTTCAAGTACACGACGGTCTCGAGACCGTCGTGTACTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-906s1c1
Sequence:CCGGCAGCAAGGAGTGTGTGTTCATCTCGAGATGAACACACACTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-805s1c1
Sequence:CCGGACAGACACCTTCGGTAGTCAACTCGAGTTGACTACCGAAGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-930s21c1
Sequence:CCGGGAAGGTTCTGGAGAACAACTACTCGAGTAGTTGTTCTCCAGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-956s21c1
Sequence:CCGGCCCTGATGTCGGCTAAGTACTCTCGAGAGTACTTAGCCGACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003862.1-1369s21c1
Sequence:CCGGCTCACGCAAAGGGACTGTAGTCTCGAGACTACAGTCCCTTTGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-857s21c1
Sequence:CCGGACCTGTGCATGAACCGCAAAGCTCGAGCTTTGCGGTTCATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003862
FGF18 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1050s1c1
Sequence:CCGGCGTGCATTTCATGAAGCGCTACTCGAGTAGCGCTTCATGAAATGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-714s1c1
Sequence:CCGGCCGGACCAGTGGGAAACACATCTCGAGATGTGTTTCCCACTGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-1098s1c1
Sequence:CCGGGCCCTTCAAGTACACGACGGTCTCGAGACCGTCGTGTACTTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-906s1c1
Sequence:CCGGCAGCAAGGAGTGTGTGTTCATCTCGAGATGAACACACACTCCTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003862.1-805s1c1
Sequence:CCGGACAGACACCTTCGGTAGTCAACTCGAGTTGACTACCGAAGGTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-930s21c1
Sequence:CCGGGAAGGTTCTGGAGAACAACTACTCGAGTAGTTGTTCTCCAGAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-956s21c1
Sequence:CCGGCCCTGATGTCGGCTAAGTACTCTCGAGAGTACTTAGCCGACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003862.1-1369s21c1
Sequence:CCGGCTCACGCAAAGGGACTGTAGTCTCGAGACTACAGTCCCTTTGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003862.1-857s21c1
Sequence:CCGGACCTGTGCATGAACCGCAAAGCTCGAGCTTTGCGGTTCATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks