EMAIL THIS PAGE TO A FRIEND

FGF19

fibroblast growth factor 19

37 Gene Product Result for
UniProtKB ID: O95750
Gene ID:
Human(9965) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
Rat(170582) fibroblast growth factor 19
Zebrafish(368245) fibroblast growth factor 19
chicken(395394) fibroblast growth factor 19
dog(483681) fibroblast growth factor 19
cow(521475) fibroblast growth factor 19
domestic cat(101087099) fibroblast growth factor 19
naked mole-rat(101710827) fibroblast growth factor 19
sheep(101115744) fibroblast growth factor 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005117 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027451 MISSION® esiRNA esiRNA human FGF19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005117 Rosetta Predictions human pricing
NM_130753 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161005 predicted 932
2 SASI_Hs01_00161006 predicted 472
3 SASI_Hs01_00161007 predicted 1005
4 SASI_Hs01_00161008 predicted 471
5 SASI_Hs01_00161009 predicted 794
6 SASI_Hs01_00161010 predicted 903
7 SASI_Hs01_00161011 predicted 840
8 SASI_Hs01_00161012 predicted 1094
9 SASI_Hs02_00339013 predicted 1042
10 SASI_Hs01_00161013 predicted 1582
11 SASI_Hs01_00161014 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082536 predicted 343
2 SASI_Rn01_00082537 predicted 381
3 SASI_Rn01_00082538 predicted 239
4 SASI_Rn01_00082539 predicted 324
5 SASI_Rn01_00082540 predicted 336
6 SASI_Rn01_00082541 predicted 365
7 SASI_Rn01_00082542 predicted 237
8 SASI_Rn01_00082544 predicted 353
9 SASI_Rn01_00082545 predicted 357
10 SASI_Rn02_00267490 predicted 385
11 SASI_Rn01_00082543 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005117
FGF19 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 19
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1292s21c1
Sequence:CCGGACTTGTCTGATCATAACATTGCTCGAGCAATGTTATGATCAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1577s21c1
Sequence:CCGGCCATGTGGGAATTGATCTATACTCGAGTATAGATCAATTCCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005117.2-1043s21c1
Sequence:CCGGACCGACAGCATGGACCCATTTCTCGAGAAATGGGTCCATGCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-1006s1c1
Sequence:CCGGCCACTTGGAATCTGACATGTTCTCGAGAACATGTCAGATTCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-688s1c1
Sequence:CCGGCGCGCACAGTTTGCTGGAGATCTCGAGATCTCCAGCAAACTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-936s1c1
Sequence:CCGGGCTTTCTTCCACTCTCTCATTCTCGAGAATGAGAGAGTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-920s1c1
Sequence:CCGGCTGTACAAGAACAGAGGCTTTCTCGAGAAAGCCTCTGTTCTTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-856s1c1
Sequence:CCGGCAATGTGTACCGATCCGAGAACTCGAGTTCTCGGATCGGTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005117
FGF19 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 19
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1292s21c1
Sequence:CCGGACTTGTCTGATCATAACATTGCTCGAGCAATGTTATGATCAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1577s21c1
Sequence:CCGGCCATGTGGGAATTGATCTATACTCGAGTATAGATCAATTCCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005117.2-1043s21c1
Sequence:CCGGACCGACAGCATGGACCCATTTCTCGAGAAATGGGTCCATGCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-1006s1c1
Sequence:CCGGCCACTTGGAATCTGACATGTTCTCGAGAACATGTCAGATTCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-688s1c1
Sequence:CCGGCGCGCACAGTTTGCTGGAGATCTCGAGATCTCCAGCAAACTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-936s1c1
Sequence:CCGGGCTTTCTTCCACTCTCTCATTCTCGAGAATGAGAGAGTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-920s1c1
Sequence:CCGGCTGTACAAGAACAGAGGCTTTCTCGAGAAAGCCTCTGTTCTTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-856s1c1
Sequence:CCGGCAATGTGTACCGATCCGAGAACTCGAGTTCTCGGATCGGTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005117
FGF19 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 19
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1292s21c1
Sequence:CCGGACTTGTCTGATCATAACATTGCTCGAGCAATGTTATGATCAGACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372316    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005117.2-1577s21c1
Sequence:CCGGCCATGTGGGAATTGATCTATACTCGAGTATAGATCAATTCCCACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005117.2-1043s21c1
Sequence:CCGGACCGACAGCATGGACCCATTTCTCGAGAAATGGGTCCATGCTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-1006s1c1
Sequence:CCGGCCACTTGGAATCTGACATGTTCTCGAGAACATGTCAGATTCCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-688s1c1
Sequence:CCGGCGCGCACAGTTTGCTGGAGATCTCGAGATCTCCAGCAAACTGTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-936s1c1
Sequence:CCGGGCTTTCTTCCACTCTCTCATTCTCGAGAATGAGAGAGTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-920s1c1
Sequence:CCGGCTGTACAAGAACAGAGGCTTTCTCGAGAAAGCCTCTGTTCTTGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005117.2-856s1c1
Sequence:CCGGCAATGTGTACCGATCCGAGAACTCGAGTTCTCGGATCGGTACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks