EMAIL THIS PAGE TO A FRIEND

FGF1

fibroblast growth factor 1 (acidic)

184 Gene Product Result for
Synonyms: AFGF ECGF ECGF-beta ECGFA ECGFB FGF-1 FGF-alpha FGFA GLIO703 HBGF-1 HBGF1
UniProtKB ID: P05230, B2R5T0, D3DQF2, P07502, Q16588
Gene ID:
Human(2246) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009]
Mouse(14164) fibroblast growth factor 1
Rat(25317) fibroblast growth factor 1 (acidic)
sheep(101109353) fibroblast growth factor 1 (acidic)
Domestic Rabbit(100328898) fibroblast growth factor 1 (acidic)
sheep(780480) fibroblast growth factor 1 (acidic)
domestic guinea pig(100727152) fibroblast growth factor 1 (acidic)
chicken(396094) fibroblast growth factor 1 (acidic)
dog(607724) fibroblast growth factor 1 (acidic)
Horse(100033960) fibroblast growth factor 1 (acidic)
cow(281160) fibroblast growth factor 1 (acidic)
domestic cat(101082206) fibroblast growth factor 1 (acidic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405808 Anti-FGF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA003265 Anti-FGF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106316 Anti-FGF1 antibody produced in rabbit affinity isolated antibody human, rat, horse, sheep, guinea pig, rabbit
ELISA, western blot pricing
SAB2106328 Anti-FGF1 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, sheep, human, horse, rabbit
ELISA, western blot pricing
SAB1410382 Anti-FGF1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
F5521 Anti-Fibroblast Growth Factor-Acidic antibody produced in rabbit IgG fraction of antiserum, lyophilized powder bovine, human
ELISA, neutralization, western blot pricing
WH0002246M1 Monoclonal Anti-FGF1 antibody produced in mouse clone 3F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403812 Monoclonal Anti-FGF1, (C-terminal) antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
F9666 Monoclonal Anti-Fibroblast Growth Factor-Acidic antibody produced in mouse clone FA-88, purified immunoglobulin, buffered aqueous solution bovine, human
ELISA, neutralization, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000800 Rosetta Predictions human pricing
NM_033136 Rosetta Predictions human pricing
NM_033137 Rosetta Predictions human pricing
NM_012846 Rosetta Predictions rat pricing
NM_010197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200637 predicted 930
2 SASI_Hs01_00200638 predicted 959
3 SASI_Hs01_00200639 predicted 875
4 SASI_Hs01_00200640 predicted 799
5 SASI_Hs01_00200642 predicted 898
6 SASI_Hs01_00200643 predicted 953
7 SASI_Hs01_00200644 predicted 1048
8 SASI_Hs01_00200645 predicted 963
9 SASI_Hs02_00303247 predicted 998
10 SASI_Hs01_00200646 predicted 820
11 SASI_Hs01_00200641 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032029 predicted 619
2 SASI_Hs01_00032030 predicted 616
3 SASI_Hs01_00032031 predicted 703
4 SASI_Hs01_00032032 predicted 794
5 SASI_Hs01_00032034 predicted 485
6 SASI_Hs01_00032035 predicted 314
7 SASI_Hs01_00032036 predicted 349
8 SASI_Hs01_00032037 predicted 500
9 SASI_Hs02_00360867 predicted 195
10 SASI_Hs01_00032038 predicted 309
11 SASI_Hs01_00032033 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125006 predicted 621
2 SASI_Hs01_00125007 predicted 606
3 SASI_Hs01_00125008 predicted 693
4 SASI_Hs01_00125009 predicted 789
5 SASI_Hs01_00125010 predicted 489
6 SASI_Hs01_00125011 predicted 483
7 SASI_Hs01_00125012 predicted 353
8 SASI_Hs01_00125013 predicted 503
9 SASI_Hs02_00360868 predicted 197
10 SASI_Hs01_00125014 predicted 349
11 SASI_Hs01_00125015 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012846 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069483 predicted 332
2 SASI_Rn01_00069484 predicted 938
3 SASI_Rn02_00260315 predicted 508
4 SASI_Rn01_00069485 predicted 446
5 SASI_Rn01_00069486 predicted 834
6 SASI_Rn01_00069488 predicted 796
7 SASI_Rn01_00069489 predicted 460
8 SASI_Rn01_00069491 predicted 783
9 SASI_Rn02_00260316 predicted 936
10 SASI_Rn02_00260317 predicted 551
11 SASI_Rn01_00069487 predicted 427
12 SASI_Rn01_00069490 predicted 822
13 SASI_Rn01_00069492 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099615 predicted 428
2 SASI_Mm01_00099616 predicted 867
3 SASI_Mm01_00099617 predicted 829
4 SASI_Mm01_00099618 predicted 239
5 SASI_Mm01_00099619 predicted 710
6 SASI_Mm01_00099620 predicted 381
7 SASI_Mm01_00099621 predicted 701
8 SASI_Mm01_00099622 predicted 862
9 SASI_Mm01_00099623 predicted 453
10 SASI_Mm01_00099624 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033137
VALIDATED
FGF1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 1 (acidic)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-172s1c1
Sequence:CCGGGCCCTGACCGAGAAGTTTAATCTCGAGATTAAACTTCTCGGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033137.1-298s1c1
Sequence:CCGGAGCGACCAGCACAACACCAAACTCGAGTTTGGTGTTGTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-219s1c1
Sequence:CCGGCAAACTCCTCTACTGTAGCAACTCGAGTTGCTACAGTAGAGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-181s1c2
Sequence:CCGGGAGAAGTTTAATCTGCCTCCACTCGAGTGGAGGCAGATTAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033137.1-1233s1c2
Sequence:CCGGCCTGATAACAAGCAAGGATATCTCGAGATATCCTTGCTTGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033137
VALIDATED
FGF1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 1 (acidic)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-172s1c1
Sequence:CCGGGCCCTGACCGAGAAGTTTAATCTCGAGATTAAACTTCTCGGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033137.1-298s1c1
Sequence:CCGGAGCGACCAGCACAACACCAAACTCGAGTTTGGTGTTGTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-219s1c1
Sequence:CCGGCAAACTCCTCTACTGTAGCAACTCGAGTTGCTACAGTAGAGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-181s1c2
Sequence:CCGGGAGAAGTTTAATCTGCCTCCACTCGAGTGGAGGCAGATTAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033137.1-1233s1c2
Sequence:CCGGCCTGATAACAAGCAAGGATATCTCGAGATATCCTTGCTTGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033137
VALIDATED
FGF1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 1 (acidic)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-172s1c1
Sequence:CCGGGCCCTGACCGAGAAGTTTAATCTCGAGATTAAACTTCTCGGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033137.1-298s1c1
Sequence:CCGGAGCGACCAGCACAACACCAAACTCGAGTTTGGTGTTGTGCTGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-219s1c1
Sequence:CCGGCAAACTCCTCTACTGTAGCAACTCGAGTTGCTACAGTAGAGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_033137.1-181s1c2
Sequence:CCGGGAGAAGTTTAATCTGCCTCCACTCGAGTGGAGGCAGATTAAACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033137.1-1233s1c2
Sequence:CCGGCCTGATAACAAGCAAGGATATCTCGAGATATCCTTGCTTGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010197
VALIDATED
FGF1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 1 (acidic)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-388s1c1
Sequence:CCGGGCGAAGTGTATATAAAGGGTACTCGAGTACCCTTTATATACACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010197.2-1991s1c1
Sequence:CCGGCCAGCAAATTAGAAACACTATCTCGAGATAGTGTTTCTAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-537s1c1
Sequence:CCGGCATGCGGAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTCCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010197.2-239s1c1
Sequence:CCGGCCTGCCTCTAGGAAACTACAACTCGAGTTGTAGTTTCCTAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-460s1c1
Sequence:CCGGCGCAGACACCAAATGAGGAATCTCGAGATTCCTCATTTGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010197.3-649s21c1
Sequence:CCGGTGACTAGAGGAGTCTGTTCTGCTCGAGCAGAACAGACTCCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010197.3-731s21c1
Sequence:CCGGAGGCCACAGAGCCTGAATTTGCTCGAGCAAATTCAGGCTCTGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010197
VALIDATED
FGF1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 1 (acidic)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-388s1c1
Sequence:CCGGGCGAAGTGTATATAAAGGGTACTCGAGTACCCTTTATATACACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010197.2-1991s1c1
Sequence:CCGGCCAGCAAATTAGAAACACTATCTCGAGATAGTGTTTCTAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-537s1c1
Sequence:CCGGCATGCGGAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTCCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010197.2-239s1c1
Sequence:CCGGCCTGCCTCTAGGAAACTACAACTCGAGTTGTAGTTTCCTAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-460s1c1
Sequence:CCGGCGCAGACACCAAATGAGGAATCTCGAGATTCCTCATTTGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010197.3-649s21c1
Sequence:CCGGTGACTAGAGGAGTCTGTTCTGCTCGAGCAGAACAGACTCCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010197.3-731s21c1
Sequence:CCGGAGGCCACAGAGCCTGAATTTGCTCGAGCAAATTCAGGCTCTGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010197
VALIDATED
FGF1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 1 (acidic)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-388s1c1
Sequence:CCGGGCGAAGTGTATATAAAGGGTACTCGAGTACCCTTTATATACACTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010197.2-1991s1c1
Sequence:CCGGCCAGCAAATTAGAAACACTATCTCGAGATAGTGTTTCTAATTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-537s1c1
Sequence:CCGGCATGCGGAGAAGAACTGGTTTCTCGAGAAACCAGTTCTTCTCCGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010197.2-239s1c1
Sequence:CCGGCCTGCCTCTAGGAAACTACAACTCGAGTTGTAGTTTCCTAGAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010197.2-460s1c1
Sequence:CCGGCGCAGACACCAAATGAGGAATCTCGAGATTCCTCATTTGGTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010197.3-649s21c1
Sequence:CCGGTGACTAGAGGAGTCTGTTCTGCTCGAGCAGAACAGACTCCTCTAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010197.3-731s21c1
Sequence:CCGGAGGCCACAGAGCCTGAATTTGCTCGAGCAAATTCAGGCTCTGTGGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks