EMAIL THIS PAGE TO A FRIEND

FGF20

fibroblast growth factor 20

Synonyms: FGF-20
UniProtKB ID: Q9NP95, B2RPH5
Gene ID:
Human(26281) Summary: The protein encoded by this gene is a member of the fibroblast growth factor family. The fibroblast growth factors possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene product is a secreted neurotrophic factor but lacks a typical signal peptide. It is expressed in normal brain, particularly the cerebellum, and may regulate central nervous system development and function. Homodimerization of this protein was shown to regulate its receptor binding activity and concentration gradient in the extracellular matrix. Genetic variations of this gene have been associated with Parkinson disease susceptibility. [provided by RefSeq, Oct 2009]
Mouse(80857) fibroblast growth factor 20
Rat(66017) fibroblast growth factor 20
domestic guinea pig(100732836) fibroblast growth factor 20
naked mole-rat(101701734) fibroblast growth factor 20
sheep(101121489) fibroblast growth factor 20
chicken(428779) fibroblast growth factor 20
dog(606908) fibroblast growth factor 20
cow(539083) fibroblast growth factor 20
domestic cat(101083766) fibroblast growth factor 20
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107826 Anti-FGF20 antibody produced in rabbit affinity isolated antibody sheep, rabbit, goat, horse, guinea pig, human
ELISA, western blot pricing
SAB4300843 Anti-FGF20 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry pricing
SAB1305263 ANTI-FGF20(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP4589 FGF-20 human recombinant, expressed in E. coli, ≥90% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019851 Rosetta Predictions human pricing
NM_023961 Rosetta Predictions rat pricing
NM_030610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197168 predicted 600
2 SASI_Hs01_00197169 predicted 543
3 SASI_Hs01_00197171 predicted 574
4 SASI_Hs01_00197172 predicted 504
5 SASI_Hs01_00197173 predicted 656
6 SASI_Hs02_00352870 predicted 577
7 SASI_Hs01_00197174 predicted 515
8 SASI_Hs01_00197175 predicted 552
9 SASI_Hs02_00352871 predicted 527
10 SASI_Hs02_00352872 predicted 631
11 SASI_Hs01_00197170 predicted 575
12 SASI_Hs01_00197176 predicted 672
13 SASI_Hs01_00197177 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050557 predicted 371
2 SASI_Rn01_00050558 predicted 352
3 SASI_Rn01_00050559 predicted 406
4 SASI_Rn01_00050560 predicted 381
5 SASI_Rn01_00050561 predicted 267
6 SASI_Rn01_00050562 predicted 278
7 SASI_Rn01_00050563 predicted 388
8 SASI_Rn01_00050564 predicted 222
9 SASI_Rn02_00263768 predicted 272
10 SASI_Rn02_00263769 predicted 277
11 SASI_Rn01_00050556 predicted 342
12 SASI_Rn01_00050565 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200650 predicted 368
2 SASI_Mm01_00200651 predicted 265
3 SASI_Mm01_00200652 predicted 401
4 SASI_Mm01_00200653 predicted 382
5 SASI_Mm01_00200654 predicted 283
6 SASI_Mm01_00200655 predicted 354
7 SASI_Mm01_00200656 predicted 365
8 SASI_Mm01_00200657 predicted 376
9 SASI_Mm01_00200658 predicted 275
10 SASI_Mm01_00200659 predicted 272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019851
FGF20 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 20
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-610s21c1
Sequence:CCGGAGACACTGGCCGCAGGTATTTCTCGAGAAATACCTGCGGCCAGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-767s21c1
Sequence:CCGGTGAAGTGCGATAGTGACATTACTCGAGTAATGTCACTATCGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-412s1c1
Sequence:CCGGCCTCTTCGGTATCTTGGAATTCTCGAGAATTCCAAGATACCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-734s1c1
Sequence:CCGGCCAGAATTGTACAAGGACCTACTCGAGTAGGTCCTTGTACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-522s1c1
Sequence:CCGGCAGAGAAACTTACTTCCGAATCTCGAGATTCGGAAGTAAGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-635s1c1
Sequence:CCGGGCACTTAACAAAGACGGAACTCTCGAGAGTTCCGTCTTTGTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-542s1c1
Sequence:CCGGTGCATCTTTAGGGAGCAGTTTCTCGAGAAACTGCTCCCTAAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019851
FGF20 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 20
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-610s21c1
Sequence:CCGGAGACACTGGCCGCAGGTATTTCTCGAGAAATACCTGCGGCCAGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-767s21c1
Sequence:CCGGTGAAGTGCGATAGTGACATTACTCGAGTAATGTCACTATCGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-412s1c1
Sequence:CCGGCCTCTTCGGTATCTTGGAATTCTCGAGAATTCCAAGATACCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-734s1c1
Sequence:CCGGCCAGAATTGTACAAGGACCTACTCGAGTAGGTCCTTGTACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-522s1c1
Sequence:CCGGCAGAGAAACTTACTTCCGAATCTCGAGATTCGGAAGTAAGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-635s1c1
Sequence:CCGGGCACTTAACAAAGACGGAACTCTCGAGAGTTCCGTCTTTGTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-542s1c1
Sequence:CCGGTGCATCTTTAGGGAGCAGTTTCTCGAGAAACTGCTCCCTAAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019851
FGF20 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 20
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-610s21c1
Sequence:CCGGAGACACTGGCCGCAGGTATTTCTCGAGAAATACCTGCGGCCAGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019851.2-767s21c1
Sequence:CCGGTGAAGTGCGATAGTGACATTACTCGAGTAATGTCACTATCGCACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-412s1c1
Sequence:CCGGCCTCTTCGGTATCTTGGAATTCTCGAGAATTCCAAGATACCGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-734s1c1
Sequence:CCGGCCAGAATTGTACAAGGACCTACTCGAGTAGGTCCTTGTACAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-522s1c1
Sequence:CCGGCAGAGAAACTTACTTCCGAATCTCGAGATTCGGAAGTAAGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-635s1c1
Sequence:CCGGGCACTTAACAAAGACGGAACTCTCGAGAGTTCCGTCTTTGTTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019851.1-542s1c1
Sequence:CCGGTGCATCTTTAGGGAGCAGTTTCTCGAGAAACTGCTCCCTAAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030610
FGF20 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-362s1c1
Sequence:CCGGTGAATGACAAAGGAGAACTTTCTCGAGAAAGTTCTCCTTTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-409s1c1
Sequence:CCGGTGCATCTTCAGGGAACAATTTCTCGAGAAATTGTTCCCTGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-433s1c1
Sequence:CCGGGAGAACTGGTATAATACCTATCTCGAGATAGGTATTATACCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-269s1c1
Sequence:CCGGAGGATCACAGTCTCTTCGGTACTCGAGTACCGAAGAGACTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-376s1c1
Sequence:CCGGGAACTTTATGGATCAGAGAAACTCGAGTTTCTCTGATCCATAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030610
FGF20 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-362s1c1
Sequence:CCGGTGAATGACAAAGGAGAACTTTCTCGAGAAAGTTCTCCTTTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-409s1c1
Sequence:CCGGTGCATCTTCAGGGAACAATTTCTCGAGAAATTGTTCCCTGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-433s1c1
Sequence:CCGGGAGAACTGGTATAATACCTATCTCGAGATAGGTATTATACCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-269s1c1
Sequence:CCGGAGGATCACAGTCTCTTCGGTACTCGAGTACCGAAGAGACTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-376s1c1
Sequence:CCGGGAACTTTATGGATCAGAGAAACTCGAGTTTCTCTGATCCATAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030610
FGF20 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-362s1c1
Sequence:CCGGTGAATGACAAAGGAGAACTTTCTCGAGAAAGTTCTCCTTTGTCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-409s1c1
Sequence:CCGGTGCATCTTCAGGGAACAATTTCTCGAGAAATTGTTCCCTGAAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-433s1c1
Sequence:CCGGGAGAACTGGTATAATACCTATCTCGAGATAGGTATTATACCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-269s1c1
Sequence:CCGGAGGATCACAGTCTCTTCGGTACTCGAGTACCGAAGAGACTGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030610.1-376s1c1
Sequence:CCGGGAACTTTATGGATCAGAGAAACTCGAGTTTCTCTGATCCATAAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks