EMAIL THIS PAGE TO A FRIEND

FGF21

fibroblast growth factor 21

73 Gene Product Result for
UniProtKB ID: Q9NSA1, Q8N683
Gene ID:
Human(26291) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The function of this growth factor has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(56636) fibroblast growth factor 21
Rat(170580) fibroblast growth factor 21
Zebrafish(724048) fibroblast growth factor 21
domestic cat(101080595) fibroblast growth factor 21
dog(484395) fibroblast growth factor 21
cow(785576) fibroblast growth factor 21
sheep(101108510) fibroblast growth factor 21
naked mole-rat(101717974) fibroblast growth factor 21
domestic guinea pig(100728398) fibroblast growth factor 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407309 Anti-FGF21 antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
western blot pricing
SAB2108136 Anti-FGF21 antibody produced in rabbit affinity isolated antibody rat, mouse, guinea pig, rabbit, horse, pig, human, canine, bovine
immunohistochemistry, western blot pricing
SAB2100815 Anti-FGF21 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, pig, human, bovine, mouse, horse, canine, rabbit
western blot pricing
HPA061286 Anti-FGF21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1410510 Anti-FGF21 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2500399 Anti-Fibroblast Growth Factor 21 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
WH0026291M1 Monoclonal Anti-FGF21 antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1405015 Monoclonal Anti-FGF21 antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409095 Monoclonal Anti-FGF21 antibody produced in mouse clone 3G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019113 Rosetta Predictions human pricing
NM_130752 Rosetta Predictions rat pricing
NM_020013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245512 predicted 471
2 SASI_Hs02_00352743 predicted 275
3 SASI_Hs01_00245513 predicted 398
4 SASI_Hs01_00245514 predicted 404
5 SASI_Hs01_00245515 predicted 440
6 SASI_Hs01_00245517 predicted 249
7 SASI_Hs01_00245518 predicted 280
8 SASI_Hs01_00245519 predicted 285
9 SASI_Hs01_00245520 predicted 418
10 SASI_Hs01_00245521 predicted 406
11 SASI_Hs01_00245516 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041196 predicted 321
2 SASI_Rn01_00041198 predicted 323
3 SASI_Rn01_00041199 predicted 381
4 SASI_Rn01_00041200 predicted 285
5 SASI_Rn01_00041201 predicted 385
6 SASI_Rn02_00267487 predicted 375
7 SASI_Rn01_00041204 predicted 333
8 SASI_Rn01_00041205 predicted 373
9 SASI_Rn02_00267488 predicted 280
10 SASI_Rn02_00267489 predicted 286
11 SASI_Rn01_00041197 predicted 299
12 SASI_Rn01_00041202 predicted 370
13 SASI_Rn01_00041203 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050273 predicted 508
2 SASI_Mm01_00050274 predicted 510
3 SASI_Mm01_00050275 predicted 572
4 SASI_Mm01_00050276 predicted 467
5 SASI_Mm01_00050277 predicted 500
6 SASI_Mm01_00050278 predicted 370
7 SASI_Mm01_00050279 predicted 468
8 SASI_Mm01_00050280 predicted 464
9 SASI_Mm01_00050281 predicted 568
10 SASI_Mm01_00050282 predicted 507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019113
FGF21 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-261s1c1
Sequence:CCGGGCCGGGAGTTATTCAAATCTTCTCGAGAAGATTTGAATAACTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-139s1c1
Sequence:CCGGCGGTACCTCTACACAGATGATCTCGAGATCATCTGTGTAGAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-327s1c1
Sequence:CCGGCCTGTATGGATCGCTCCACTTCTCGAGAAGTGGAGCGATCCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-394s1c1
Sequence:CCGGTACAATGTTTACCAGTCCGAACTCGAGTTCGGACTGGTAAACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-378s1c1
Sequence:CCGGGCTTCTTGAGGACGGATACAACTCGAGTTGTATCCGTCCTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-178s21c1
Sequence:CCGGCACTCAGGACTGTGGGTTTCTCTCGAGAGAAACCCACAGTCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-250s21c1
Sequence:CCGGTCCAGTCCTCTCCTGCAATTCCTCGAGGAATTGCAGGAGAGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-433s21c1
Sequence:CCGGGGAGTCAAGACATCCAGGTTCCTCGAGGAACCTGGATGTCTTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019113
FGF21 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-261s1c1
Sequence:CCGGGCCGGGAGTTATTCAAATCTTCTCGAGAAGATTTGAATAACTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-139s1c1
Sequence:CCGGCGGTACCTCTACACAGATGATCTCGAGATCATCTGTGTAGAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-327s1c1
Sequence:CCGGCCTGTATGGATCGCTCCACTTCTCGAGAAGTGGAGCGATCCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-394s1c1
Sequence:CCGGTACAATGTTTACCAGTCCGAACTCGAGTTCGGACTGGTAAACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-378s1c1
Sequence:CCGGGCTTCTTGAGGACGGATACAACTCGAGTTGTATCCGTCCTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-178s21c1
Sequence:CCGGCACTCAGGACTGTGGGTTTCTCTCGAGAGAAACCCACAGTCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-250s21c1
Sequence:CCGGTCCAGTCCTCTCCTGCAATTCCTCGAGGAATTGCAGGAGAGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-433s21c1
Sequence:CCGGGGAGTCAAGACATCCAGGTTCCTCGAGGAACCTGGATGTCTTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019113
FGF21 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-261s1c1
Sequence:CCGGGCCGGGAGTTATTCAAATCTTCTCGAGAAGATTTGAATAACTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-139s1c1
Sequence:CCGGCGGTACCTCTACACAGATGATCTCGAGATCATCTGTGTAGAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-327s1c1
Sequence:CCGGCCTGTATGGATCGCTCCACTTCTCGAGAAGTGGAGCGATCCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-394s1c1
Sequence:CCGGTACAATGTTTACCAGTCCGAACTCGAGTTCGGACTGGTAAACATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019113.1-378s1c1
Sequence:CCGGGCTTCTTGAGGACGGATACAACTCGAGTTGTATCCGTCCTCAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-178s21c1
Sequence:CCGGCACTCAGGACTGTGGGTTTCTCTCGAGAGAAACCCACAGTCCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-250s21c1
Sequence:CCGGTCCAGTCCTCTCCTGCAATTCCTCGAGGAATTGCAGGAGAGGACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019113.2-433s21c1
Sequence:CCGGGGAGTCAAGACATCCAGGTTCCTCGAGGAACCTGGATGTCTTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020013
VALIDATED
FGF21 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020013.2-332s1c1
Sequence:CCGGCTCTACACAGATGACGACCAACTCGAGTTGGTCGTCATCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-767s1c1
Sequence:CCGGCTGAGCATGGTAGAGCCTTTACTCGAGTAAAGGCTCTACCATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-514s1c1
Sequence:CCGGTCTCTATGGATCGCCTCACTTCTCGAGAAGTGAGGCGATCCATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-457s1c1
Sequence:CCGGCATTCAAATCCTGGGTGTCAACTCGAGTTGACACCCAGGATTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-341s1c1
Sequence:CCGGGATGACGACCAAGACACTGAACTCGAGTTCAGTGTCTTGGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-640s21c1
Sequence:CCGGCCCAAACCAGGATGCAACATCCTCGAGGATGTTGCATCCTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-516s21c1
Sequence:CCGGTCTATGGATCGCCTCACTTTGCTCGAGCAAAGTGAGGCGATCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-768s21c1
Sequence:CCGGTGAGCATGGTAGAGCCTTTACCTCGAGGTAAAGGCTCTACCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-459s21c1
Sequence:CCGGTTCAAATCCTGGGTGTCAAAGCTCGAGCTTTGACACCCAGGATTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-567s21c1
Sequence:CCGGTGCTGGAGGACGGTTACAATGCTCGAGCATTGTAACCGTCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020013
VALIDATED
FGF21 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020013.2-332s1c1
Sequence:CCGGCTCTACACAGATGACGACCAACTCGAGTTGGTCGTCATCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-767s1c1
Sequence:CCGGCTGAGCATGGTAGAGCCTTTACTCGAGTAAAGGCTCTACCATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-514s1c1
Sequence:CCGGTCTCTATGGATCGCCTCACTTCTCGAGAAGTGAGGCGATCCATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-457s1c1
Sequence:CCGGCATTCAAATCCTGGGTGTCAACTCGAGTTGACACCCAGGATTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-341s1c1
Sequence:CCGGGATGACGACCAAGACACTGAACTCGAGTTCAGTGTCTTGGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-640s21c1
Sequence:CCGGCCCAAACCAGGATGCAACATCCTCGAGGATGTTGCATCCTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-516s21c1
Sequence:CCGGTCTATGGATCGCCTCACTTTGCTCGAGCAAAGTGAGGCGATCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-768s21c1
Sequence:CCGGTGAGCATGGTAGAGCCTTTACCTCGAGGTAAAGGCTCTACCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-459s21c1
Sequence:CCGGTTCAAATCCTGGGTGTCAAAGCTCGAGCTTTGACACCCAGGATTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-567s21c1
Sequence:CCGGTGCTGGAGGACGGTTACAATGCTCGAGCATTGTAACCGTCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020013
VALIDATED
FGF21 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_020013.2-332s1c1
Sequence:CCGGCTCTACACAGATGACGACCAACTCGAGTTGGTCGTCATCTGTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-767s1c1
Sequence:CCGGCTGAGCATGGTAGAGCCTTTACTCGAGTAAAGGCTCTACCATGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-514s1c1
Sequence:CCGGTCTCTATGGATCGCCTCACTTCTCGAGAAGTGAGGCGATCCATAGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-457s1c1
Sequence:CCGGCATTCAAATCCTGGGTGTCAACTCGAGTTGACACCCAGGATTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020013.2-341s1c1
Sequence:CCGGGATGACGACCAAGACACTGAACTCGAGTTCAGTGTCTTGGTCGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-640s21c1
Sequence:CCGGCCCAAACCAGGATGCAACATCCTCGAGGATGTTGCATCCTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-516s21c1
Sequence:CCGGTCTATGGATCGCCTCACTTTGCTCGAGCAAAGTGAGGCGATCCATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-768s21c1
Sequence:CCGGTGAGCATGGTAGAGCCTTTACCTCGAGGTAAAGGCTCTACCATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-459s21c1
Sequence:CCGGTTCAAATCCTGGGTGTCAAAGCTCGAGCTTTGACACCCAGGATTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020013.4-567s21c1
Sequence:CCGGTGCTGGAGGACGGTTACAATGCTCGAGCATTGTAACCGTCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks