EMAIL THIS PAGE TO A FRIEND

FGF22

fibroblast growth factor 22

44 Gene Product Result for
UniProtKB ID: Q9HCT0, B2RPH4
Gene ID:
Human(27006) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. [provided by RefSeq, Jul 2008]
Mouse(67112) fibroblast growth factor 22
Rat(170579) fibroblast growth factor 22
domestic guinea pig(100721186) fibroblast growth factor 22
naked mole-rat(101720536) fibroblast growth factor 22
sheep(101114608) fibroblast growth factor 22
Zebrafish(100005852) fibroblast growth factor 22
cow(519657) fibroblast growth factor 22
domestic cat(101083745) fibroblast growth factor 22
chicken(100858338) fibroblast growth factor 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1458 Human FGF-22 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026321 MISSION® esiRNA esiRNA targeting mouse Fgf22 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020637 Rosetta Predictions human pricing
NM_130751 Rosetta Predictions rat pricing
NM_023304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081294 predicted 206
2 SASI_Hs01_00081295 predicted 193
3 SASI_Hs01_00081296 predicted 118
4 SASI_Hs01_00081297 predicted 298
5 SASI_Hs01_00081298 predicted 298
6 SASI_Hs01_00081299 predicted 358
7 SASI_Hs01_00081300 predicted 310
8 SASI_Hs01_00081301 predicted 214
9 SASI_Hs01_00081302 predicted 216
10 SASI_Hs01_00081303 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069227 predicted 217
2 SASI_Rn01_00069228 predicted 230
3 SASI_Rn01_00069229 predicted 244
4 SASI_Rn01_00069230 predicted 236
5 SASI_Rn01_00069232 predicted 242
6 SASI_Rn01_00069233 predicted 199
7 SASI_Rn01_00069234 predicted 210
8 SASI_Rn01_00069235 predicted 219
9 SASI_Rn01_00069236 predicted 210
10 SASI_Rn02_00267486 predicted 236
11 SASI_Rn01_00069231 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161870 predicted 229
2 SASI_Mm01_00161871 predicted 242
3 SASI_Mm01_00161872 predicted 241
4 SASI_Mm01_00161873 predicted 215
5 SASI_Mm01_00161874 predicted 243
6 SASI_Mm01_00161875 predicted 195
7 SASI_Mm01_00161876 predicted 222
8 SASI_Mm01_00161877 predicted 207
9 SASI_Mm01_00161878 predicted 227
10 SASI_Mm01_00161879 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020637
FGF22 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 22
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-262s21c1
Sequence:CCGGGCAGTGTCCTCAGGCTTCTACCTCGAGGTAGAAGCCTGAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-217s21c1
Sequence:CCGGATCCTGGAGATCCGCTCTGTACTCGAGTACAGAGCGGATCTCCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-251s1c1
Sequence:CCGGTGGTCATCAAAGCAGTGTCCTCTCGAGAGGACACTGCTTTGATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-317s1c1
Sequence:CCGGCGCGACTCTACACCGTGGACTCTCGAGAGTCCACGGTGTAGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-148s1c1
Sequence:CCGGCACTTCTTCCTGCGCGTGGATCTCGAGATCCACGCGCAGGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-345s1c1
Sequence:CCGGCCGGGAGCGCATCGAAGAGAACTCGAGTTCTCTTCGATGCGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-270s1c1
Sequence:CCGGCTCAGGCTTCTACGTGGCCATCTCGAGATGGCCACGTAGAAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020637
FGF22 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 22
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-262s21c1
Sequence:CCGGGCAGTGTCCTCAGGCTTCTACCTCGAGGTAGAAGCCTGAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-217s21c1
Sequence:CCGGATCCTGGAGATCCGCTCTGTACTCGAGTACAGAGCGGATCTCCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-251s1c1
Sequence:CCGGTGGTCATCAAAGCAGTGTCCTCTCGAGAGGACACTGCTTTGATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-317s1c1
Sequence:CCGGCGCGACTCTACACCGTGGACTCTCGAGAGTCCACGGTGTAGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-148s1c1
Sequence:CCGGCACTTCTTCCTGCGCGTGGATCTCGAGATCCACGCGCAGGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-345s1c1
Sequence:CCGGCCGGGAGCGCATCGAAGAGAACTCGAGTTCTCTTCGATGCGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-270s1c1
Sequence:CCGGCTCAGGCTTCTACGTGGCCATCTCGAGATGGCCACGTAGAAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020637
FGF22 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 22
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-262s21c1
Sequence:CCGGGCAGTGTCCTCAGGCTTCTACCTCGAGGTAGAAGCCTGAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020637.1-217s21c1
Sequence:CCGGATCCTGGAGATCCGCTCTGTACTCGAGTACAGAGCGGATCTCCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-251s1c1
Sequence:CCGGTGGTCATCAAAGCAGTGTCCTCTCGAGAGGACACTGCTTTGATGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-317s1c1
Sequence:CCGGCGCGACTCTACACCGTGGACTCTCGAGAGTCCACGGTGTAGAGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-148s1c1
Sequence:CCGGCACTTCTTCCTGCGCGTGGATCTCGAGATCCACGCGCAGGAAGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-345s1c1
Sequence:CCGGCCGGGAGCGCATCGAAGAGAACTCGAGTTCTCTTCGATGCGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020637.1-270s1c1
Sequence:CCGGCTCAGGCTTCTACGTGGCCATCTCGAGATGGCCACGTAGAAGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023304
FGF22 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-180s1c1
Sequence:CCGGCCAGGACAGTATAGTGGAGATCTCGAGATCTCCACTATACTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-290s1c1
Sequence:CCGGCGCGGGTCTACTCTGTGGACTCTCGAGAGTCCACAGAGTAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-235s1c1
Sequence:CCGGGCTGTGTACTCAGGCTTCTATCTCGAGATAGAAGCCTGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-105s1c1
Sequence:CCGGCCTCTTCTCCTCCACTCACTTCTCGAGAAGTGAGTGGAGGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-327s1c1
Sequence:CCGGCATCGAGGAGAACGGCTACAACTCGAGTTGTAGCCGTTCTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023304
FGF22 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-180s1c1
Sequence:CCGGCCAGGACAGTATAGTGGAGATCTCGAGATCTCCACTATACTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-290s1c1
Sequence:CCGGCGCGGGTCTACTCTGTGGACTCTCGAGAGTCCACAGAGTAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-235s1c1
Sequence:CCGGGCTGTGTACTCAGGCTTCTATCTCGAGATAGAAGCCTGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-105s1c1
Sequence:CCGGCCTCTTCTCCTCCACTCACTTCTCGAGAAGTGAGTGGAGGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-327s1c1
Sequence:CCGGCATCGAGGAGAACGGCTACAACTCGAGTTGTAGCCGTTCTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023304
FGF22 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-180s1c1
Sequence:CCGGCCAGGACAGTATAGTGGAGATCTCGAGATCTCCACTATACTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-290s1c1
Sequence:CCGGCGCGGGTCTACTCTGTGGACTCTCGAGAGTCCACAGAGTAGACCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-235s1c1
Sequence:CCGGGCTGTGTACTCAGGCTTCTATCTCGAGATAGAAGCCTGAGTACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-105s1c1
Sequence:CCGGCCTCTTCTCCTCCACTCACTTCTCGAGAAGTGAGTGGAGGAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023304.1-327s1c1
Sequence:CCGGCATCGAGGAGAACGGCTACAACTCGAGTTGTAGCCGTTCTCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks