EMAIL THIS PAGE TO A FRIEND

FGF23

fibroblast growth factor 23

73 Gene Product Result for
Synonyms: ADHR FGFN HPDR2 HYPF PHPTC
UniProtKB ID: Q9GZV9, Q4V758
Gene ID:
Human(8074) Summary: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC). [provided by RefSeq, Feb 2013]
Mouse(64654) fibroblast growth factor 23
Rat(170583) fibroblast growth factor 23
Zebrafish(494456) fibroblast growth factor 23
cow(530239) fibroblast growth factor 23
domestic cat(101100063) fibroblast growth factor 23
dog(611773) fibroblast growth factor 23
chicken(428104) fibroblast growth factor 23
sheep(101112475) fibroblast growth factor 23
naked mole-rat(101713698) fibroblast growth factor 23
domestic guinea pig(100717518) fibroblast growth factor 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020638 Rosetta Predictions human pricing
NM_130754 Rosetta Predictions rat pricing
NM_022657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179471 predicted 564
2 SASI_Hs01_00179472 predicted 523
3 SASI_Hs01_00179474 predicted 458
4 SASI_Hs01_00179475 predicted 432
5 SASI_Hs01_00179476 predicted 528
6 SASI_Hs01_00179477 predicted 378
7 SASI_Hs01_00179478 predicted 412
8 SASI_Hs01_00179479 predicted 472
9 SASI_Hs02_00353614 predicted 411
10 SASI_Hs02_00353615 predicted 521
11 SASI_Hs01_00179470 predicted 291
12 SASI_Hs01_00179473 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031566 predicted 284
2 SASI_Rn01_00031569 predicted 362
3 SASI_Rn02_00267491 predicted 205
4 SASI_Rn02_00267492 predicted 417
5 SASI_Rn02_00267493 predicted 380
6 SASI_Rn02_00267494 predicted 402
7 SASI_Rn01_00031572 predicted 423
8 SASI_Rn01_00031573 predicted 282
9 SASI_Rn01_00031574 predicted 459
10 SASI_Rn01_00031575 predicted 370
11 SASI_Rn01_00031567 predicted 231
12 SASI_Rn01_00031568 predicted 268
13 SASI_Rn01_00031570 predicted 272
14 SASI_Rn01_00031571 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085194 predicted 292
2 SASI_Mm01_00085195 predicted 392
3 SASI_Mm01_00085197 predicted 274
4 SASI_Mm01_00085198 predicted 288
5 SASI_Mm01_00085202 predicted 386
6 SASI_Mm01_00085203 predicted 900
7 SASI_Mm02_00326637 predicted 276
8 SASI_Mm02_00326638 predicted 408
9 SASI_Mm02_00326639 predicted 276
10 SASI_Mm02_00326640 predicted 491
11 SASI_Mm01_00085196 predicted 365
12 SASI_Mm01_00085199 predicted 311
13 SASI_Mm01_00085200 predicted 1200
14 SASI_Mm01_00085201 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020638
FGF23 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 23
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-428s1c1
Sequence:CCGGCTGCATGGATTTCAGAGGCAACTCGAGTTGCCTCTGAAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-782s1c1
Sequence:CCGGCGCCGAGGACAACAGCCCGATCTCGAGATCGGGCTGTTGTCCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-461s1c1
Sequence:CCGGACACTATTTCGACCCGGAGAACTCGAGTTCTCCGGGTCGAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-527s1c1
Sequence:CCGGCCACTCTCCTCAGTATCACTTCTCGAGAAGTGATACTGAGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-381s1c1
Sequence:CCGGGATGCTGGCTTTGTGGTGATTCTCGAGAATCACCACAAAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1093s21c1
Sequence:CCGGCCGCCTTCCTCACTCCATATACTCGAGTATATGGAGTGAGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020638.2-208s21c1
Sequence:CCGGTCCTCAGAGCCTATCCCAATGCTCGAGCATTGGGATAGGCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1184s21c1
Sequence:CCGGGGGTCTCTCCCAACATATTTCCTCGAGGAAATATGTTGGGAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020638
FGF23 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 23
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-428s1c1
Sequence:CCGGCTGCATGGATTTCAGAGGCAACTCGAGTTGCCTCTGAAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-782s1c1
Sequence:CCGGCGCCGAGGACAACAGCCCGATCTCGAGATCGGGCTGTTGTCCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-461s1c1
Sequence:CCGGACACTATTTCGACCCGGAGAACTCGAGTTCTCCGGGTCGAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-527s1c1
Sequence:CCGGCCACTCTCCTCAGTATCACTTCTCGAGAAGTGATACTGAGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-381s1c1
Sequence:CCGGGATGCTGGCTTTGTGGTGATTCTCGAGAATCACCACAAAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1093s21c1
Sequence:CCGGCCGCCTTCCTCACTCCATATACTCGAGTATATGGAGTGAGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020638.2-208s21c1
Sequence:CCGGTCCTCAGAGCCTATCCCAATGCTCGAGCATTGGGATAGGCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1184s21c1
Sequence:CCGGGGGTCTCTCCCAACATATTTCCTCGAGGAAATATGTTGGGAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020638
FGF23 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 23
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-428s1c1
Sequence:CCGGCTGCATGGATTTCAGAGGCAACTCGAGTTGCCTCTGAAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-782s1c1
Sequence:CCGGCGCCGAGGACAACAGCCCGATCTCGAGATCGGGCTGTTGTCCTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-461s1c1
Sequence:CCGGACACTATTTCGACCCGGAGAACTCGAGTTCTCCGGGTCGAAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-527s1c1
Sequence:CCGGCCACTCTCCTCAGTATCACTTCTCGAGAAGTGATACTGAGGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020638.2-381s1c1
Sequence:CCGGGATGCTGGCTTTGTGGTGATTCTCGAGAATCACCACAAAGCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1093s21c1
Sequence:CCGGCCGCCTTCCTCACTCCATATACTCGAGTATATGGAGTGAGGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020638.2-208s21c1
Sequence:CCGGTCCTCAGAGCCTATCCCAATGCTCGAGCATTGGGATAGGCTCTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020638.2-1184s21c1
Sequence:CCGGGGGTCTCTCCCAACATATTTCCTCGAGGAAATATGTTGGGAGAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022657
FGF23 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 23
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000067483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-205s1c1
Sequence:CCGGGCTATCACCTACAGATCCATACTCGAGTATGGATCTGTAGGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-552s1c1
Sequence:CCGGCTGCTGCATTTCTACACTGTTCTCGAGAACAGTGTAGAAATGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-323s1c1
Sequence:CCGGGACTCGAAGGTTCCTTTGTATCTCGAGATACAAAGGAACCTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-437s1c1
Sequence:CCGGCTTGTCGCAGAAGCATCACTACTCGAGTAGTGATGCTTCTGCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022657
FGF23 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 23
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000067483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-205s1c1
Sequence:CCGGGCTATCACCTACAGATCCATACTCGAGTATGGATCTGTAGGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-552s1c1
Sequence:CCGGCTGCTGCATTTCTACACTGTTCTCGAGAACAGTGTAGAAATGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-323s1c1
Sequence:CCGGGACTCGAAGGTTCCTTTGTATCTCGAGATACAAAGGAACCTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-437s1c1
Sequence:CCGGCTTGTCGCAGAAGCATCACTACTCGAGTAGTGATGCTTCTGCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022657
FGF23 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 23
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000067483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-205s1c1
Sequence:CCGGGCTATCACCTACAGATCCATACTCGAGTATGGATCTGTAGGTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-552s1c1
Sequence:CCGGCTGCTGCATTTCTACACTGTTCTCGAGAACAGTGTAGAAATGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-323s1c1
Sequence:CCGGGACTCGAAGGTTCCTTTGTATCTCGAGATACAAAGGAACCTTCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022657.2-437s1c1
Sequence:CCGGCTTGTCGCAGAAGCATCACTACTCGAGTAGTGATGCTTCTGCGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks