EMAIL THIS PAGE TO A FRIEND

FGF2

fibroblast growth factor 2 (basic)

84 Gene Product Result for
Synonyms: BFGF FGF-2 FGFB HBGF-2
Gene ID:
Human(2247) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members bind heparin and possess broad mitogenic and angiogenic activities. This protein has been implicated in diverse biological processes, such as limb and nervous system development, wound healing, and tumor growth. The mRNA for this gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties. The CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF. [provided by RefSeq, Jul 2008]
Mouse(14173) fibroblast growth factor 2
Rat(54250) fibroblast growth factor 2
Zebrafish(404231) fibroblast growth factor 2
cow(281161) fibroblast growth factor 2 (basic)
Horse(100033955) fibroblast growth factor 2 (basic)
domestic cat(100135772) fibroblast growth factor 2 (basic)
dog(403857) fibroblast growth factor 2 (basic)
chicken(396413) fibroblast growth factor 2 (basic)
sheep(443306) fibroblast growth factor 2 (basic)
Domestic Rabbit(100009068) fibroblast growth factor 2 (basic)
naked mole-rat(101720583) fibroblast growth factor 2 (basic)
domestic guinea pig(100721182) fibroblast growth factor 2 (basic)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104919 Anti-FGF2 (46-60) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2108135 Anti-FGF2 antibody produced in rabbit affinity isolated antibody rat, bovine, horse, canine, guinea pig, mouse, rabbit, zebrafish, human
immunohistochemistry, western blot pricing
SAB2100814 Anti-FGF2 antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, rat, canine, human, mouse, chicken, rabbit, horse, bovine, rabbit
western blot pricing
SAB1306327 ANTI-FGF2-T254 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
F3393 Anti-Fibroblast Growth Factor-Basic (1-24) antibody produced in rabbit fractionated antiserum, lyophilized powder bovine, human, rat
ELISA, immunohistochemistry, western blot pricing
F5180 Anti-Fibroblast Growth Factor-Basic antibody produced in goat affinity isolated antibody, lyophilized powder human, bovine
immunohistochemistry, neutralization, western blot pricing
F5537 Anti-Fibroblast Growth Factor-Basic antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
dot blot, neutralization, radioimmunoassay, western blot pricing
SAB3300013 Monoclonal Anti-BFGF antibody produced in mouse clone 2H11, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, western blot pricing
SAB5300470 Monoclonal Anti-FGF2 antibody produced in mouse clone 2H5G2C11, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
F6162 Monoclonal Anti-Fibroblast Growth Factor-Basic antibody produced in mouse clone FB-8, purified immunoglobulin, buffered aqueous solution human, bovine
dot blot, ELISA, neutralization, radioimmunoassay, western blot pricing
F5305 Monoclonal Anti-Fibroblast Growth Factor-Basic antibody produced in mouse clone 10060, purified immunoglobulin, lyophilized powder human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002006 Rosetta Predictions human pricing
NM_019305 Rosetta Predictions rat pricing
NM_008006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230118 predicted 1019
2 SASI_Hs01_00230119 predicted 1018
3 SASI_Hs01_00230120 predicted 722
4 SASI_Hs01_00230121 predicted 719
5 SASI_Hs01_00230122 predicted 1025
6 SASI_Hs01_00230123 predicted 950
7 SASI_Hs01_00230124 predicted 859
8 SASI_Hs01_00230126 predicted 780
9 SASI_Hs01_00230127 predicted 709
10 SASI_Hs02_00333005 predicted 814
11 SASI_Hs01_00230125 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262262 predicted 614
2 SASI_Rn02_00262263 predicted 667
3 SASI_Rn02_00262264 predicted 794
4 SASI_Rn02_00262265 predicted 759
5 SASI_Rn01_00043970 predicted 733
6 SASI_Rn01_00043971 predicted 753
7 SASI_Rn02_00262266 predicted 690
8 SASI_Rn02_00262267 predicted 764
9 SASI_Rn02_00262268 predicted 534
10 SASI_Rn02_00262269 predicted 610
11 SASI_Rn01_00043967 predicted 913
12 SASI_Rn01_00043968 predicted 966
13 SASI_Rn01_00043969 predicted 853
14 SASI_Rn01_00043972 predicted 809
15 SASI_Rn01_00043973 predicted 989
16 SASI_Rn01_00043974 predicted 923
17 SASI_Rn01_00043975 predicted 981
18 SASI_Rn01_00043976 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312936 predicted 463
2 SASI_Mm01_00024087 predicted 428
3 SASI_Mm01_00024088 predicted 399
4 SASI_Mm02_00312937 predicted 454
5 SASI_Mm02_00312938 predicted 386
6 SASI_Mm02_00312939 predicted 361
7 SASI_Mm01_00024089 predicted 429
8 SASI_Mm01_00024090 predicted 391
9 SASI_Mm02_00312940 predicted 462
10 SASI_Mm02_00312941 predicted 350
11 SASI_Mm01_00024086 predicted 234
12 SASI_Mm01_00024091 predicted 235
13 SASI_Mm01_00024092 predicted 226
14 SASI_Mm01_00024093 predicted 212
15 SASI_Mm01_00024094 predicted 234
16 SASI_Mm01_00024095 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002006
FGF2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 2 (basic)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-798s1c1
Sequence:CCGGACTACAATACTTACCGGTCAACTCGAGTTGACCGGTAAGTATTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-635s1c1
Sequence:CCGGGACCCTCACATCAAGCTACAACTCGAGTTGTAGCTTGATGTGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-684s1c1
Sequence:CCGGCTATCAAAGGAGTGTGTGCTACTCGAGTAGCACACACTCCTTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-755s1c1
Sequence:CCGGGTTACGGATGAGTGTTTCTTTCTCGAGAAAGAAACACTCATCCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002006.x-5916s1c1
Sequence:CCGGGCAGTCATAAACAGAAGAATACTCGAGTATTCTTCTGTTTATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002006.4-1024s21c1
Sequence:CCGGTATAGCTCAGTTTGGATAATTCTCGAGAATTATCCAAACTGAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-733s21c1
Sequence:CCGGGAAGATTACTGGCTTCTAAATCTCGAGATTTAGAAGCCAGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-848s21c1
Sequence:CCGGGAAACGAACTGGGCAGTATAACTCGAGTTATACTGCCCAGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-779s21c1
Sequence:CCGGTGAACGATTGGAATCTAATAACTCGAGTTATTAGATTCCAATCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002006
FGF2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 2 (basic)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-798s1c1
Sequence:CCGGACTACAATACTTACCGGTCAACTCGAGTTGACCGGTAAGTATTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-635s1c1
Sequence:CCGGGACCCTCACATCAAGCTACAACTCGAGTTGTAGCTTGATGTGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-684s1c1
Sequence:CCGGCTATCAAAGGAGTGTGTGCTACTCGAGTAGCACACACTCCTTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-755s1c1
Sequence:CCGGGTTACGGATGAGTGTTTCTTTCTCGAGAAAGAAACACTCATCCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002006.x-5916s1c1
Sequence:CCGGGCAGTCATAAACAGAAGAATACTCGAGTATTCTTCTGTTTATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002006.4-1024s21c1
Sequence:CCGGTATAGCTCAGTTTGGATAATTCTCGAGAATTATCCAAACTGAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-733s21c1
Sequence:CCGGGAAGATTACTGGCTTCTAAATCTCGAGATTTAGAAGCCAGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-848s21c1
Sequence:CCGGGAAACGAACTGGGCAGTATAACTCGAGTTATACTGCCCAGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-779s21c1
Sequence:CCGGTGAACGATTGGAATCTAATAACTCGAGTTATTAGATTCCAATCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002006
FGF2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 2 (basic)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-798s1c1
Sequence:CCGGACTACAATACTTACCGGTCAACTCGAGTTGACCGGTAAGTATTGTAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-635s1c1
Sequence:CCGGGACCCTCACATCAAGCTACAACTCGAGTTGTAGCTTGATGTGAGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-684s1c1
Sequence:CCGGCTATCAAAGGAGTGTGTGCTACTCGAGTAGCACACACTCCTTTGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002006.x-755s1c1
Sequence:CCGGGTTACGGATGAGTGTTTCTTTCTCGAGAAAGAAACACTCATCCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002006.x-5916s1c1
Sequence:CCGGGCAGTCATAAACAGAAGAATACTCGAGTATTCTTCTGTTTATGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002006.4-1024s21c1
Sequence:CCGGTATAGCTCAGTTTGGATAATTCTCGAGAATTATCCAAACTGAGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-733s21c1
Sequence:CCGGGAAGATTACTGGCTTCTAAATCTCGAGATTTAGAAGCCAGTAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-848s21c1
Sequence:CCGGGAAACGAACTGGGCAGTATAACTCGAGTTATACTGCCCAGTTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002006.4-779s21c1
Sequence:CCGGTGAACGATTGGAATCTAATAACTCGAGTTATTAGATTCCAATCGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008006
FGF2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 2 (basic)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-274s1c1
Sequence:CCGGGCTTCTAAGTGTGTTACAGAACTCGAGTTCTGTAACACACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-172s1c1
Sequence:CCGGCACGTCAAACTACAACTCCAACTCGAGTTGGAGTTGTAGTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-292s1c1
Sequence:CCGGGAAGAGTGTTTCTTCTTTGAACTCGAGTTCAAAGAAGAAACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-201s1c1
Sequence:CCGGGAGAGGAGTTGTGTCTATCAACTCGAGTTGATAGACACAACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-238s1c1
Sequence:CCGGCGGTACCTTGCTATGAAGGAACTCGAGTTCCTTCATAGCAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008006
FGF2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 2 (basic)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-274s1c1
Sequence:CCGGGCTTCTAAGTGTGTTACAGAACTCGAGTTCTGTAACACACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-172s1c1
Sequence:CCGGCACGTCAAACTACAACTCCAACTCGAGTTGGAGTTGTAGTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-292s1c1
Sequence:CCGGGAAGAGTGTTTCTTCTTTGAACTCGAGTTCAAAGAAGAAACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-201s1c1
Sequence:CCGGGAGAGGAGTTGTGTCTATCAACTCGAGTTGATAGACACAACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-238s1c1
Sequence:CCGGCGGTACCTTGCTATGAAGGAACTCGAGTTCCTTCATAGCAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008006
FGF2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 2 (basic)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-274s1c1
Sequence:CCGGGCTTCTAAGTGTGTTACAGAACTCGAGTTCTGTAACACACTTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-172s1c1
Sequence:CCGGCACGTCAAACTACAACTCCAACTCGAGTTGGAGTTGTAGTTTGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-292s1c1
Sequence:CCGGGAAGAGTGTTTCTTCTTTGAACTCGAGTTCAAAGAAGAAACACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-201s1c1
Sequence:CCGGGAGAGGAGTTGTGTCTATCAACTCGAGTTGATAGACACAACTCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008006.1-238s1c1
Sequence:CCGGCGGTACCTTGCTATGAAGGAACTCGAGTTCCTTCATAGCAAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks