EMAIL THIS PAGE TO A FRIEND

FGF4

fibroblast growth factor 4

60 Gene Product Result for
Synonyms: HBGF-4 HST HST-1 HSTF1 K-FGF KFGF
UniProtKB ID: P08620
Gene ID:
Human(2249) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its oncogenic transforming activity. This gene and FGF3, another oncogenic growth factor, are located closely on chromosome 11. Co-amplification of both genes was found in various kinds of human tumors. Studies on the mouse homolog suggested a function in bone morphogenesis and limb development through the sonic hedgehog (SHH) signaling pathway. [provided by RefSeq, Jul 2008]
Mouse(14175) fibroblast growth factor 4
Rat(116499) fibroblast growth factor 4
sheep(101116004) fibroblast growth factor 4
naked mole-rat(101711919) fibroblast growth factor 4
domestic guinea pig(100730350) fibroblast growth factor 4
Zebrafish(570435) fibroblast growth factor 4
cow(618474) fibroblast growth factor 4
dog(483680) fibroblast growth factor 4
chicken(428857) fibroblast growth factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002007 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002007 Rosetta Predictions human pricing
NM_053809 Rosetta Predictions rat pricing
NM_010202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090057 predicted 793
2 SASI_Hs01_00090058 predicted 456
3 SASI_Hs01_00090059 predicted 818
4 SASI_Hs01_00090060 predicted 537
5 SASI_Hs01_00090061 predicted 500
6 SASI_Hs01_00090062 predicted 558
7 SASI_Hs01_00090063 predicted 764
8 SASI_Hs01_00090064 predicted 746
9 SASI_Hs01_00090065 predicted 450
10 SASI_Hs01_00090066 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062532 predicted 355
2 SASI_Rn01_00062533 predicted 202
3 SASI_Rn01_00062534 predicted 204
4 SASI_Rn01_00062535 predicted 359
5 SASI_Rn01_00062536 predicted 358
6 SASI_Rn01_00062537 predicted 358
7 SASI_Rn01_00062538 predicted 271
8 SASI_Rn01_00062539 predicted 255
9 SASI_Rn01_00062540 predicted 253
10 SASI_Rn01_00062541 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029820 predicted 579
2 SASI_Mm01_00029821 predicted 624
3 SASI_Mm01_00029822 predicted 651
4 SASI_Mm01_00029823 predicted 1214
5 SASI_Mm01_00029824 predicted 688
6 SASI_Mm01_00029825 predicted 958
7 SASI_Mm01_00029827 predicted 986
8 SASI_Mm02_00318014 predicted 564
9 SASI_Mm02_00318015 predicted 960
10 SASI_Mm02_00318016 predicted 957
11 SASI_Mm01_00029826 predicted 704
12 SASI_Mm01_00029828 predicted 999
13 SASI_Mm01_00029829 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010202
FGF4 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-445s1c1
Sequence:CCGGGACGAGTGTAAATTCAAAGAACTCGAGTTCTTTGAATTTACACTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-459s1c1
Sequence:CCGGCAAAGAAATACTTCTGCCCAACTCGAGTTGGGCAGAAGTATTTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-384s1c1
Sequence:CCGGCAGCCGGTTCTTCGTGGCTATCTCGAGATAGCCACGAAGAACCGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-211s1c1
Sequence:CCGGGACTACCTGCTGGGCCTCAAACTCGAGTTTGAGGCCCAGCAGGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-421s1c1
Sequence:CCGGCTCTTCGGTGTGCCTTTCTTTCTCGAGAAAGAAAGGCACACCGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010202.5-636s21c1
Sequence:CCGGATGTTCATGGCCCTCAGTAAGCTCGAGCTTACTGAGGGCCATGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010202.5-1162s21c1
Sequence:CCGGGAACCCTGTCGGATCGGTTTACTCGAGTAAACCGATCCGACAGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010202
FGF4 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-445s1c1
Sequence:CCGGGACGAGTGTAAATTCAAAGAACTCGAGTTCTTTGAATTTACACTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-459s1c1
Sequence:CCGGCAAAGAAATACTTCTGCCCAACTCGAGTTGGGCAGAAGTATTTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-384s1c1
Sequence:CCGGCAGCCGGTTCTTCGTGGCTATCTCGAGATAGCCACGAAGAACCGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-211s1c1
Sequence:CCGGGACTACCTGCTGGGCCTCAAACTCGAGTTTGAGGCCCAGCAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-421s1c1
Sequence:CCGGCTCTTCGGTGTGCCTTTCTTTCTCGAGAAAGAAAGGCACACCGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010202.5-636s21c1
Sequence:CCGGATGTTCATGGCCCTCAGTAAGCTCGAGCTTACTGAGGGCCATGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010202.5-1162s21c1
Sequence:CCGGGAACCCTGTCGGATCGGTTTACTCGAGTAAACCGATCCGACAGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010202
FGF4 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-445s1c1
Sequence:CCGGGACGAGTGTAAATTCAAAGAACTCGAGTTCTTTGAATTTACACTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-459s1c1
Sequence:CCGGCAAAGAAATACTTCTGCCCAACTCGAGTTGGGCAGAAGTATTTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-384s1c1
Sequence:CCGGCAGCCGGTTCTTCGTGGCTATCTCGAGATAGCCACGAAGAACCGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-211s1c1
Sequence:CCGGGACTACCTGCTGGGCCTCAAACTCGAGTTTGAGGCCCAGCAGGTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010202.1-421s1c1
Sequence:CCGGCTCTTCGGTGTGCCTTTCTTTCTCGAGAAAGAAAGGCACACCGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010202.5-636s21c1
Sequence:CCGGATGTTCATGGCCCTCAGTAAGCTCGAGCTTACTGAGGGCCATGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010202.5-1162s21c1
Sequence:CCGGGAACCCTGTCGGATCGGTTTACTCGAGTAAACCGATCCGACAGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002007
FGF4 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-748s1c1
Sequence:CCGGCAAGCTCTATGGCTCGCCCTTCTCGAGAAGGGCGAGCCATAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-538s1c1
Sequence:CCGGCGGCGACTACCTGCTGGGCATCTCGAGATGCCCAGCAGGTAGTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-820s1c1
Sequence:CCGGCGCCTACGAGTCCTACAAGTACTCGAGTACTTGTAGGACTCGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-790s1c1
Sequence:CCGGCAAGGAGATTCTCCTTCCCAACTCGAGTTGGGAAGGAGAATCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-862s1c1
Sequence:CCGGGAGCAAGAATGGGAAGACCAACTCGAGTTGGTCTTCCCATTCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-994s21c1
Sequence:CCGGGAGGGTCACCTTGGTGCACTTCTCGAGAAGTGCACCAAGGTGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-1039s21c1
Sequence:CCGGAGAGTAGGTGTAAGATATTTACTCGAGTAAATATCTTACACCTACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002007.2-908s21c1
Sequence:CCGGATGAAGGTCACCCACTTCCTCCTCGAGGAGGAAGTGGGTGACCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002007
FGF4 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-748s1c1
Sequence:CCGGCAAGCTCTATGGCTCGCCCTTCTCGAGAAGGGCGAGCCATAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-538s1c1
Sequence:CCGGCGGCGACTACCTGCTGGGCATCTCGAGATGCCCAGCAGGTAGTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-820s1c1
Sequence:CCGGCGCCTACGAGTCCTACAAGTACTCGAGTACTTGTAGGACTCGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-790s1c1
Sequence:CCGGCAAGGAGATTCTCCTTCCCAACTCGAGTTGGGAAGGAGAATCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-862s1c1
Sequence:CCGGGAGCAAGAATGGGAAGACCAACTCGAGTTGGTCTTCCCATTCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-994s21c1
Sequence:CCGGGAGGGTCACCTTGGTGCACTTCTCGAGAAGTGCACCAAGGTGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-1039s21c1
Sequence:CCGGAGAGTAGGTGTAAGATATTTACTCGAGTAAATATCTTACACCTACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002007.2-908s21c1
Sequence:CCGGATGAAGGTCACCCACTTCCTCCTCGAGGAGGAAGTGGGTGACCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002007
FGF4 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-748s1c1
Sequence:CCGGCAAGCTCTATGGCTCGCCCTTCTCGAGAAGGGCGAGCCATAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-538s1c1
Sequence:CCGGCGGCGACTACCTGCTGGGCATCTCGAGATGCCCAGCAGGTAGTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-820s1c1
Sequence:CCGGCGCCTACGAGTCCTACAAGTACTCGAGTACTTGTAGGACTCGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-790s1c1
Sequence:CCGGCAAGGAGATTCTCCTTCCCAACTCGAGTTGGGAAGGAGAATCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002007.1-862s1c1
Sequence:CCGGGAGCAAGAATGGGAAGACCAACTCGAGTTGGTCTTCCCATTCTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-994s21c1
Sequence:CCGGGAGGGTCACCTTGGTGCACTTCTCGAGAAGTGCACCAAGGTGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002007.2-1039s21c1
Sequence:CCGGAGAGTAGGTGTAAGATATTTACTCGAGTAAATATCTTACACCTACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002007.2-908s21c1
Sequence:CCGGATGAAGGTCACCCACTTCCTCCTCGAGGAGGAAGTGGGTGACCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)