EMAIL THIS PAGE TO A FRIEND

FGF5

fibroblast growth factor 5

200 Gene Product Result for
Synonyms: HBGF-5 Smag-82
UniProtKB ID: P12034, B2R554, O75846, Q3Y8M3
Gene ID:
Human(2250) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified as an oncogene, which confers transforming potential when transfected into mammalian cells. Targeted disruption of the homolog of this gene in mouse resulted in the phenotype of abnormally long hair, which suggested a function as an inhibitor of hair elongation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(14176) fibroblast growth factor 5
Rat(60662) fibroblast growth factor 5
Zebrafish(494454) fibroblast growth factor 5
dog(608459) fibroblast growth factor 5
cow(536771) fibroblast growth factor 5
domestic cat(100136904) fibroblast growth factor 5
chicken(770457) fibroblast growth factor 5
domestic guinea pig(100722934) fibroblast growth factor 5
naked mole-rat(101700281) fibroblast growth factor 5
Goat(100861298) fibroblast growth factor 5
sheep(100642180) fibroblast growth factor 5
Domestic Rabbit(100316906) fibroblast growth factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004464 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004464 Rosetta Predictions human pricing
NM_033143 Rosetta Predictions human pricing
NM_022211 Rosetta Predictions rat pricing
NM_010203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142295 predicted 904
2 SASI_Hs01_00142296 predicted 919
3 SASI_Hs02_00337665 predicted 1122
4 SASI_Hs01_00142297 predicted 1126
5 SASI_Hs01_00142298 predicted 1136
6 SASI_Hs01_00142299 predicted 350
7 SASI_Hs01_00142300 predicted 1160
8 SASI_Hs01_00142301 predicted 1154
9 SASI_Hs01_00142302 predicted 1209
10 SASI_Hs02_00337666 predicted 1085
11 SASI_Hs01_00142303 predicted 1028
12 SASI_Hs01_00142304 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081489 predicted 802
2 SASI_Hs01_00081490 predicted 815
3 SASI_Hs01_00081491 predicted 1020
4 SASI_Hs02_00360880 predicted 912
5 SASI_Hs01_00081492 predicted 1021
6 SASI_Hs01_00081493 predicted 1029
7 SASI_Hs01_00081494 predicted 350
8 SASI_Hs01_00081495 predicted 1063
9 SASI_Hs01_00081496 predicted 1044
10 SASI_Hs02_00360881 predicted 981
11 SASI_Hs01_00081497 predicted 923
12 SASI_Hs01_00081498 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068189 predicted 326
2 SASI_Rn01_00068190 predicted 517
3 SASI_Rn01_00068191 predicted 331
4 SASI_Rn01_00068192 predicted 295
5 SASI_Rn01_00068193 predicted 498
6 SASI_Rn01_00068194 predicted 272
7 SASI_Rn01_00068195 predicted 559
8 SASI_Rn02_00262968 predicted 447
9 SASI_Rn01_00068196 predicted 326
10 SASI_Rn02_00262969 predicted 467
11 SASI_Rn01_00068187 predicted 285
12 SASI_Rn01_00068188 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070543 predicted 1145
2 SASI_Mm01_00070544 predicted 552
3 SASI_Mm01_00070545 predicted 440
4 SASI_Mm01_00070546 predicted 425
5 SASI_Mm01_00070547 predicted 895
6 SASI_Mm01_00070548 predicted 690
7 SASI_Mm01_00070549 predicted 1074
8 SASI_Mm01_00070550 predicted 522
9 SASI_Mm01_00070551 predicted 357
10 SASI_Mm01_00070552 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010203
FGF5 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010203.4-884s21c1
Sequence:CCGGAGTCCGAGCAACCGGAACTTTCTCGAGAAAGTTCCGGTTGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010203.4-1235s21c1
Sequence:CCGGTCAGATCACCGAGGATATAAACTCGAGTTTATATCCTCGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010203.2-2311s1c1
Sequence:CCGGCGGGAATGTGATGAGCTGAAACTCGAGTTTCAGCTCATCACATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-795s1c1
Sequence:CCGGGCCCTGAACAAGAGAGGGAAACTCGAGTTTCCCTCTCTTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-989s1c1
Sequence:CCGGCCCAGTGAAGTACAGACTGAACTCGAGTTCAGTCTGTACTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-701s1c1
Sequence:CCGGCTGTAAGTTCAGGGAGAGATTCTCGAGAATCTCTCCCTGAACTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-564s1c1
Sequence:CCGGGAAGCCAGTGTGTTAAGTATTCTCGAGAATACTTAACACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010203
FGF5 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010203.4-884s21c1
Sequence:CCGGAGTCCGAGCAACCGGAACTTTCTCGAGAAAGTTCCGGTTGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010203.4-1235s21c1
Sequence:CCGGTCAGATCACCGAGGATATAAACTCGAGTTTATATCCTCGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010203.2-2311s1c1
Sequence:CCGGCGGGAATGTGATGAGCTGAAACTCGAGTTTCAGCTCATCACATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-795s1c1
Sequence:CCGGGCCCTGAACAAGAGAGGGAAACTCGAGTTTCCCTCTCTTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-989s1c1
Sequence:CCGGCCCAGTGAAGTACAGACTGAACTCGAGTTCAGTCTGTACTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-701s1c1
Sequence:CCGGCTGTAAGTTCAGGGAGAGATTCTCGAGAATCTCTCCCTGAACTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-564s1c1
Sequence:CCGGGAAGCCAGTGTGTTAAGTATTCTCGAGAATACTTAACACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010203
FGF5 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010203.4-884s21c1
Sequence:CCGGAGTCCGAGCAACCGGAACTTTCTCGAGAAAGTTCCGGTTGCTCGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010203.4-1235s21c1
Sequence:CCGGTCAGATCACCGAGGATATAAACTCGAGTTTATATCCTCGGTGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010203.2-2311s1c1
Sequence:CCGGCGGGAATGTGATGAGCTGAAACTCGAGTTTCAGCTCATCACATTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-795s1c1
Sequence:CCGGGCCCTGAACAAGAGAGGGAAACTCGAGTTTCCCTCTCTTGTTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-989s1c1
Sequence:CCGGCCCAGTGAAGTACAGACTGAACTCGAGTTCAGTCTGTACTTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-701s1c1
Sequence:CCGGCTGTAAGTTCAGGGAGAGATTCTCGAGAATCTCTCCCTGAACTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010203.2-564s1c1
Sequence:CCGGGAAGCCAGTGTGTTAAGTATTCTCGAGAATACTTAACACACTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004464
FGF5 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1154s21c1
Sequence:CCGGTGTATTGAAGTCACGTCATTTCTCGAGAAATGACGTGACTTCAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004464.3-1028s21c1
Sequence:CCGGAGTTTCGCTTTGGATAATATTCTCGAGAATATTATCCAAAGCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1284s21c1
Sequence:CCGGCTTTATGCTTGAGGGATATTTCTCGAGAAATATCCCTCAAGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-770s1c1
Sequence:CCGGCCCAGCATATCTCTACCCATTCTCGAGAATGGGTAGAGATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-253s1c1
Sequence:CCGGGCCACTGATAGGAACCCTATACTCGAGTATAGGGTTCCTATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-820s1c1
Sequence:CCGGCCAGAACTTTCTTTCACGGTTCTCGAGAACCGTGAAAGAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-487s1c1
Sequence:CCGGGAAGCCAATATGTTAAGTGTTCTCGAGAACACTTAACATATTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-665s1c1
Sequence:CCGGCCTATGCCTCAGCAATACATACTCGAGTATGTATTGCTGAGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004464
FGF5 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1154s21c1
Sequence:CCGGTGTATTGAAGTCACGTCATTTCTCGAGAAATGACGTGACTTCAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004464.3-1028s21c1
Sequence:CCGGAGTTTCGCTTTGGATAATATTCTCGAGAATATTATCCAAAGCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1284s21c1
Sequence:CCGGCTTTATGCTTGAGGGATATTTCTCGAGAAATATCCCTCAAGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-770s1c1
Sequence:CCGGCCCAGCATATCTCTACCCATTCTCGAGAATGGGTAGAGATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-253s1c1
Sequence:CCGGGCCACTGATAGGAACCCTATACTCGAGTATAGGGTTCCTATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-820s1c1
Sequence:CCGGCCAGAACTTTCTTTCACGGTTCTCGAGAACCGTGAAAGAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-487s1c1
Sequence:CCGGGAAGCCAATATGTTAAGTGTTCTCGAGAACACTTAACATATTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-665s1c1
Sequence:CCGGCCTATGCCTCAGCAATACATACTCGAGTATGTATTGCTGAGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004464
FGF5 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372260    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1154s21c1
Sequence:CCGGTGTATTGAAGTCACGTCATTTCTCGAGAAATGACGTGACTTCAATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004464.3-1028s21c1
Sequence:CCGGAGTTTCGCTTTGGATAATATTCTCGAGAATATTATCCAAAGCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004464.3-1284s21c1
Sequence:CCGGCTTTATGCTTGAGGGATATTTCTCGAGAAATATCCCTCAAGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-770s1c1
Sequence:CCGGCCCAGCATATCTCTACCCATTCTCGAGAATGGGTAGAGATATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-253s1c1
Sequence:CCGGGCCACTGATAGGAACCCTATACTCGAGTATAGGGTTCCTATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-820s1c1
Sequence:CCGGCCAGAACTTTCTTTCACGGTTCTCGAGAACCGTGAAAGAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-487s1c1
Sequence:CCGGGAAGCCAATATGTTAAGTGTTCTCGAGAACACTTAACATATTGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004464.2-665s1c1
Sequence:CCGGCCTATGCCTCAGCAATACATACTCGAGTATGTATTGCTGAGGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks