EMAIL THIS PAGE TO A FRIEND

FGF6

fibroblast growth factor 6

64 Gene Product Result for
Synonyms: HBGF-6 HST2
UniProtKB ID: P10767, Q0VAE1
Gene ID:
Human(2251) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene displayed oncogenic transforming activity when transfected into mammalian cells. The mouse homolog of this gene exhibits a restricted expression profile predominantly in the myogenic lineage, which suggested a role in muscle regeneration or differentiation. [provided by RefSeq, Jul 2008]
Mouse(14177) fibroblast growth factor 6
Rat(170700) fibroblast growth factor 6
sheep(101116719) fibroblast growth factor 6
naked mole-rat(101722884) fibroblast growth factor 6
domestic guinea pig(100730876) fibroblast growth factor 6
chicken(768907) fibroblast growth factor 6
cow(540317) fibroblast growth factor 6
domestic cat(101091459) fibroblast growth factor 6
dog(486735) fibroblast growth factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301745 Anti-FGF6 affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1301754 ANTI-FGF6 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_485825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_485825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_485825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020996 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163701 MISSION® esiRNA esiRNA targeting mouse Fgf6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020996 Rosetta Predictions human pricing
NM_131908 Rosetta Predictions rat pricing
NM_010204 Rosetta Predictions mouse pricing
XM_485825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091535 predicted 461
2 SASI_Hs01_00091536 predicted 445
3 SASI_Hs02_00354466 predicted 442
4 SASI_Hs01_00091538 predicted 520
5 SASI_Hs01_00091539 predicted 260
6 SASI_Hs01_00091540 predicted 519
7 SASI_Hs01_00091541 predicted 501
8 SASI_Hs01_00091542 predicted 493
9 SASI_Hs01_00091543 predicted 448
10 SASI_Hs01_00091544 predicted 453
11 SASI_Hs01_00091537 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093399 predicted 381
2 SASI_Rn01_00093400 predicted 346
3 SASI_Rn01_00093401 predicted 235
4 SASI_Rn01_00093402 predicted 223
5 SASI_Rn01_00093403 predicted 228
6 SASI_Rn01_00093404 predicted 210
7 SASI_Rn01_00093405 predicted 220
8 SASI_Rn01_00093406 predicted 402
9 SASI_Rn01_00093407 predicted 376
10 SASI_Rn01_00093408 predicted 195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318017 predicted 967
2 SASI_Mm02_00318018 predicted 975
3 SASI_Mm02_00318019 predicted 590
4 SASI_Mm02_00318020 predicted 282
5 SASI_Mm02_00318021 predicted 264
6 SASI_Mm02_00318022 predicted 265
7 SASI_Mm02_00318023 predicted 847
8 SASI_Mm02_00318024 predicted 630
9 SASI_Mm02_00318025 predicted 744
10 SASI_Mm02_00318026 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260953 predicted 239
2 SASI_Mm01_00260954 predicted 227
3 SASI_Mm01_00260955 predicted 717
4 SASI_Mm01_00260956 predicted 708
5 SASI_Mm01_00260957 predicted 928
6 SASI_Mm01_00260958 predicted 936
7 SASI_Mm01_00260959 predicted 544
8 SASI_Mm01_00260960 predicted 1122
9 SASI_Mm01_00260961 predicted 536
10 SASI_Mm01_00260962 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_485825
FGF6 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000067628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485825.2-1502s1c1
Sequence:CCGGCCCTCCTTAGAAGAAAGTAATCTCGAGATTACTTTCTTCTAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-743s1c1
Sequence:CCGGCCTACATTGCACTGAGCAAATCTCGAGATTTGCTCAGTGCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-113s1c1
Sequence:CCGGCCCTCTCCTATATGCCCAATACTCGAGTATTGGGCATATAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-693s1c1
Sequence:CCGGCCTCCTTCCAAACAACTACAACTCGAGTTGTAGTTGTTTGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_485825
FGF6 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000067628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485825.2-1502s1c1
Sequence:CCGGCCCTCCTTAGAAGAAAGTAATCTCGAGATTACTTTCTTCTAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-743s1c1
Sequence:CCGGCCTACATTGCACTGAGCAAATCTCGAGATTTGCTCAGTGCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-113s1c1
Sequence:CCGGCCCTCTCCTATATGCCCAATACTCGAGTATTGGGCATATAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-693s1c1
Sequence:CCGGCCTCCTTCCAAACAACTACAACTCGAGTTGTAGTTGTTTGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_485825
FGF6 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000067628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_485825.2-1502s1c1
Sequence:CCGGCCCTCCTTAGAAGAAAGTAATCTCGAGATTACTTTCTTCTAAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-743s1c1
Sequence:CCGGCCTACATTGCACTGAGCAAATCTCGAGATTTGCTCAGTGCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-113s1c1
Sequence:CCGGCCCTCTCCTATATGCCCAATACTCGAGTATTGGGCATATAGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_485825.2-693s1c1
Sequence:CCGGCCTCCTTCCAAACAACTACAACTCGAGTTGTAGTTGTTTGGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020996
FGF6 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-472s1c1
Sequence:CCGGGTAAAGGAAGATTGTACGCAACTCGAGTTGCGTACAATCTTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-417s1c1
Sequence:CCGGCGAGGCGTGGTGAGTCTCTTTCTCGAGAAAGAGACTCACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-395s1c1
Sequence:CCGGGCTGGAAATTTCCACTGTGGACTCGAGTCCACAGTGGAAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-260s1c1
Sequence:CCGGGAACTGGGAAAGTGGCTATTTCTCGAGAAATAGCCACTTTCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-439s21c1
Sequence:CCGGGAGTGAGAAGTGCCCTCTTCGCTCGAGCGAAGAGGGCACTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-635s21c1
Sequence:CCGGGATCATGACTGTCACTCATTTCTCGAGAAATGAGTGACAGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020996
FGF6 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-472s1c1
Sequence:CCGGGTAAAGGAAGATTGTACGCAACTCGAGTTGCGTACAATCTTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-417s1c1
Sequence:CCGGCGAGGCGTGGTGAGTCTCTTTCTCGAGAAAGAGACTCACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-395s1c1
Sequence:CCGGGCTGGAAATTTCCACTGTGGACTCGAGTCCACAGTGGAAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-260s1c1
Sequence:CCGGGAACTGGGAAAGTGGCTATTTCTCGAGAAATAGCCACTTTCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-439s21c1
Sequence:CCGGGAGTGAGAAGTGCCCTCTTCGCTCGAGCGAAGAGGGCACTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-635s21c1
Sequence:CCGGGATCATGACTGTCACTCATTTCTCGAGAAATGAGTGACAGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020996
FGF6 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-472s1c1
Sequence:CCGGGTAAAGGAAGATTGTACGCAACTCGAGTTGCGTACAATCTTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-417s1c1
Sequence:CCGGCGAGGCGTGGTGAGTCTCTTTCTCGAGAAAGAGACTCACCACGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-395s1c1
Sequence:CCGGGCTGGAAATTTCCACTGTGGACTCGAGTCCACAGTGGAAATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020996.1-260s1c1
Sequence:CCGGGAACTGGGAAAGTGGCTATTTCTCGAGAAATAGCCACTTTCCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-439s21c1
Sequence:CCGGGAGTGAGAAGTGCCCTCTTCGCTCGAGCGAAGAGGGCACTTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020996.1-635s21c1
Sequence:CCGGGATCATGACTGTCACTCATTTCTCGAGAAATGAGTGACAGTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks