EMAIL THIS PAGE TO A FRIEND

FGF7

fibroblast growth factor 7

160 Gene Product Result for
Synonyms: HBGF-7 KGF
UniProtKB ID: P21781
Gene ID:
Human(2252) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is a potent epithelial cell-specific growth factor, whose mitogenic activity is predominantly exhibited in keratinocytes but not in fibroblasts and endothelial cells. Studies of mouse and rat homologs of this gene implicated roles in morphogenesis of epithelium, reepithelialization of wounds, hair development and early lung organogenesis. [provided by RefSeq, Jul 2008]
Mouse(14178) fibroblast growth factor 7
Rat(29348) fibroblast growth factor 7
Zebrafish(493181) fibroblast growth factor 7
cow(616885) fibroblast growth factor 7
Horse(100033961) fibroblast growth factor 7
domestic cat(101097982) fibroblast growth factor 7
dog(403915) fibroblast growth factor 7
chicken(415439) fibroblast growth factor 7
domestic guinea pig(100718957) fibroblast growth factor 7
naked mole-rat(101714076) fibroblast growth factor 7
sheep(443095) fibroblast growth factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002009 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051641 MISSION® esiRNA esiRNA human FGF7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002009 Rosetta Predictions human pricing
NM_022182 Rosetta Predictions rat pricing
NM_008008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097196 predicted 704
2 SASI_Hs01_00097197 predicted 576
3 SASI_Hs01_00097198 predicted 468
4 SASI_Hs01_00097199 predicted 700
5 SASI_Hs01_00097201 predicted 460
6 SASI_Hs01_00097202 predicted 643
7 SASI_Hs01_00097203 predicted 666
8 SASI_Hs01_00097205 predicted 597
9 SASI_Hs02_00333006 predicted 479
10 SASI_Hs02_00333007 predicted 657
11 SASI_Hs01_00097200 predicted 496
12 SASI_Hs01_00097204 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097511 predicted 257
2 SASI_Rn01_00097512 predicted 409
3 SASI_Rn01_00097513 predicted 262
4 SASI_Rn01_00097514 predicted 387
5 SASI_Rn01_00097515 predicted 344
6 SASI_Rn01_00097516 predicted 332
7 SASI_Rn02_00262927 predicted 346
8 SASI_Rn01_00097518 predicted 415
9 SASI_Rn01_00097519 predicted 442
10 SASI_Rn01_00097520 predicted 194
11 SASI_Rn01_00097517 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145686 predicted 408
2 SASI_Mm01_00145687 predicted 1260
3 SASI_Mm01_00145689 predicted 418
4 SASI_Mm01_00145690 predicted 1405
5 SASI_Mm01_00145691 predicted 1336
6 SASI_Mm01_00145692 predicted 623
7 SASI_Mm01_00145693 predicted 1255
8 SASI_Mm02_00312946 predicted 1247
9 SASI_Mm01_00145695 predicted 1312
10 SASI_Mm02_00312947 predicted 581
11 SASI_Mm01_00145688 predicted 1278
12 SASI_Mm01_00145694 predicted 502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002009
FGF7 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-828s21c1
Sequence:CCGGTCAGGACAGTGGCAGTTGGAACTCGAGTTCCAACTGCCACTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-599s21c1
Sequence:CCGGCTAGTGGGTACTATATCTTTACTCGAGTAAAGATATAGTACCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-490s1c1
Sequence:CCGGCAGATCATGCTTTCACATTATCTCGAGATAATGTGAAAGCATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-554s1c1
Sequence:CCGGCCAGAGCAAATGGCTACAAATCTCGAGATTTGTAGCCATTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-597s1c1
Sequence:CCGGGACACACAAGAAGTTATGATTCTCGAGAATCATAACTTCTTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-706s1c1
Sequence:CCGGGACCCAAGAGATGAAGAATAACTCGAGTTATTCTTCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-1002s1c1
Sequence:CCGGCCCACTTTCTTCCTATGGCAACTCGAGTTGCCATAGGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002009
FGF7 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-828s21c1
Sequence:CCGGTCAGGACAGTGGCAGTTGGAACTCGAGTTCCAACTGCCACTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-599s21c1
Sequence:CCGGCTAGTGGGTACTATATCTTTACTCGAGTAAAGATATAGTACCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-490s1c1
Sequence:CCGGCAGATCATGCTTTCACATTATCTCGAGATAATGTGAAAGCATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-554s1c1
Sequence:CCGGCCAGAGCAAATGGCTACAAATCTCGAGATTTGTAGCCATTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-597s1c1
Sequence:CCGGGACACACAAGAAGTTATGATTCTCGAGAATCATAACTTCTTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-706s1c1
Sequence:CCGGGACCCAAGAGATGAAGAATAACTCGAGTTATTCTTCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-1002s1c1
Sequence:CCGGCCCACTTTCTTCCTATGGCAACTCGAGTTGCCATAGGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002009
FGF7 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-828s21c1
Sequence:CCGGTCAGGACAGTGGCAGTTGGAACTCGAGTTCCAACTGCCACTGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002009.3-599s21c1
Sequence:CCGGCTAGTGGGTACTATATCTTTACTCGAGTAAAGATATAGTACCCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-490s1c1
Sequence:CCGGCAGATCATGCTTTCACATTATCTCGAGATAATGTGAAAGCATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-554s1c1
Sequence:CCGGCCAGAGCAAATGGCTACAAATCTCGAGATTTGTAGCCATTTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-597s1c1
Sequence:CCGGGACACACAAGAAGTTATGATTCTCGAGAATCATAACTTCTTGTGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-706s1c1
Sequence:CCGGGACCCAAGAGATGAAGAATAACTCGAGTTATTCTTCATCTCTTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002009.2-1002s1c1
Sequence:CCGGCCCACTTTCTTCCTATGGCAACTCGAGTTGCCATAGGAAGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008008
VALIDATED
FGF7 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-909s21c1
Sequence:CCGGACACCTATGCATCAGCTAAATCTCGAGATTTAGCTGATGCATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1318s21c1
Sequence:CCGGGATGTTAGTAACGTGATATTTCTCGAGAAATATCACGTTACTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1044s21c1
Sequence:CCGGCCTAAGTGTACATGGTATTTGCTCGAGCAAATACCATGTACACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-611s21c1
Sequence:CCGGGAGCGACACACCAGAAGTTATCTCGAGATAACTTCTGGTGTGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008008.4-528s21c1
Sequence:CCGGTCTGTCTAGTGGGCACTATATCTCGAGATATAGTGCCCACTAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-659s1c1
Sequence:CCGGGTTGGAATTGTGGCAATCAAACTCGAGTTTGATTGCCACAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-1547s1c1
Sequence:CCGGGCCTGTACTGACTAATATGAACTCGAGTTCATATTAGTCAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-502s1c1
Sequence:CCGGCACCAGAAGTTATGACTACATCTCGAGATGTAGTCATAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-410s1c1
Sequence:CCGGGTCTGTCTAGTGGGCACTATACTCGAGTATAGTGCCCACTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-830s1c1
Sequence:CCGGGAAATGTTCGTTGCCTTAAATCTCGAGATTTAAGGCAACGAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008008
VALIDATED
FGF7 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-909s21c1
Sequence:CCGGACACCTATGCATCAGCTAAATCTCGAGATTTAGCTGATGCATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1318s21c1
Sequence:CCGGGATGTTAGTAACGTGATATTTCTCGAGAAATATCACGTTACTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1044s21c1
Sequence:CCGGCCTAAGTGTACATGGTATTTGCTCGAGCAAATACCATGTACACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-611s21c1
Sequence:CCGGGAGCGACACACCAGAAGTTATCTCGAGATAACTTCTGGTGTGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008008.4-528s21c1
Sequence:CCGGTCTGTCTAGTGGGCACTATATCTCGAGATATAGTGCCCACTAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-659s1c1
Sequence:CCGGGTTGGAATTGTGGCAATCAAACTCGAGTTTGATTGCCACAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-1547s1c1
Sequence:CCGGGCCTGTACTGACTAATATGAACTCGAGTTCATATTAGTCAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-502s1c1
Sequence:CCGGCACCAGAAGTTATGACTACATCTCGAGATGTAGTCATAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-410s1c1
Sequence:CCGGGTCTGTCTAGTGGGCACTATACTCGAGTATAGTGCCCACTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-830s1c1
Sequence:CCGGGAAATGTTCGTTGCCTTAAATCTCGAGATTTAAGGCAACGAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008008
VALIDATED
FGF7 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-909s21c1
Sequence:CCGGACACCTATGCATCAGCTAAATCTCGAGATTTAGCTGATGCATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1318s21c1
Sequence:CCGGGATGTTAGTAACGTGATATTTCTCGAGAAATATCACGTTACTAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-1044s21c1
Sequence:CCGGCCTAAGTGTACATGGTATTTGCTCGAGCAAATACCATGTACACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008008.4-611s21c1
Sequence:CCGGGAGCGACACACCAGAAGTTATCTCGAGATAACTTCTGGTGTGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008008.4-528s21c1
Sequence:CCGGTCTGTCTAGTGGGCACTATATCTCGAGATATAGTGCCCACTAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-659s1c1
Sequence:CCGGGTTGGAATTGTGGCAATCAAACTCGAGTTTGATTGCCACAATTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067673    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-1547s1c1
Sequence:CCGGGCCTGTACTGACTAATATGAACTCGAGTTCATATTAGTCAGTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-502s1c1
Sequence:CCGGCACCAGAAGTTATGACTACATCTCGAGATGTAGTCATAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008008.3-410s1c1
Sequence:CCGGGTCTGTCTAGTGGGCACTATACTCGAGTATAGTGCCCACTAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008008.3-830s1c1
Sequence:CCGGGAAATGTTCGTTGCCTTAAATCTCGAGATTTAAGGCAACGAACATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks