EMAIL THIS PAGE TO A FRIEND

FGF8

fibroblast growth factor 8 (androgen-induced)

Synonyms: AIGF FGF-8 HBGF-8 HH6 KAL6
UniProtKB ID: P55075, A1A514, Q14915, Q15766
Gene ID:
Human(2253) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
Mouse(14179) fibroblast growth factor 8
Rat(29349) fibroblast growth factor 8
chicken(396313) fibroblast growth factor 8 (androgen-induced)
dog(403868) fibroblast growth factor 8 (androgen-induced)
cow(326284) fibroblast growth factor 8 (androgen-induced)
domestic cat(101084652) fibroblast growth factor 8 (androgen-induced)
sheep(101113716) fibroblast growth factor 8 (androgen-induced)
Domestic Rabbit(100008834) fibroblast growth factor 8 (androgen-induced)
naked mole-rat(101699438) fibroblast growth factor 8 (androgen-induced)
domestic guinea pig(100721355) fibroblast growth factor 8 (androgen-induced)
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000361 MISSION® esiRNA esiRNA targeting mouse Fgf8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006119 Rosetta Predictions human pricing
NM_033163 Rosetta Predictions human pricing
NM_033164 Rosetta Predictions human pricing
NM_033165 Rosetta Predictions human pricing
NM_133286 Rosetta Predictions rat pricing
NM_010205 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090147 predicted 726
2 SASI_Hs02_00340942 predicted 584
3 SASI_Hs01_00090149 predicted 664
4 SASI_Hs02_00340943 predicted 731
5 SASI_Hs01_00090151 predicted 731
6 SASI_Hs02_00340944 predicted 531
7 SASI_Hs01_00090152 predicted 731
8 SASI_Hs02_00340945 predicted 678
9 SASI_Hs01_00090153 predicted 665
10 SASI_Hs01_00090154 predicted 675
11 SASI_Hs01_00090148 predicted 680
12 SASI_Hs01_00090150 predicted 672
13 SASI_Hs01_00090155 predicted 710
14 SASI_Hs01_00090156 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221812 predicted 819
2 SASI_Hs02_00360903 predicted 672
3 SASI_Hs01_00221814 predicted 757
4 SASI_Hs02_00360904 predicted 814
5 SASI_Hs01_00221816 predicted 820
6 SASI_Hs02_00360905 predicted 623
7 SASI_Hs01_00221817 predicted 821
8 SASI_Hs02_00360906 predicted 759
9 SASI_Hs01_00221818 predicted 756
10 SASI_Hs01_00221819 predicted 755
11 SASI_Hs01_00221813 predicted 760
12 SASI_Hs01_00221815 predicted 756
13 SASI_Hs01_00221820 predicted 797
14 SASI_Hs01_00221821 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161849 predicted 780
2 SASI_Hs02_00360907 predicted 632
3 SASI_Hs01_00161851 predicted 717
4 SASI_Hs02_00360908 predicted 786
5 SASI_Hs01_00161853 predicted 782
6 SASI_Hs02_00360909 predicted 590
7 SASI_Hs01_00161854 predicted 784
8 SASI_Hs02_00360910 predicted 732
9 SASI_Hs01_00161855 predicted 720
10 SASI_Hs01_00161856 predicted 728
11 SASI_Hs01_00161850 predicted 725
12 SASI_Hs01_00161852 predicted 731
13 SASI_Hs01_00161857 predicted 769
14 SASI_Hs01_00161858 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016295 predicted 698
2 SASI_Hs02_00360911 predicted 550
3 SASI_Hs01_00016297 predicted 636
4 SASI_Hs02_00360912 predicted 691
5 SASI_Hs01_00016299 predicted 698
6 SASI_Hs02_00360913 predicted 505
7 SASI_Hs01_00016300 predicted 705
8 SASI_Hs02_00360914 predicted 641
9 SASI_Hs01_00016301 predicted 635
10 SASI_Hs01_00016302 predicted 642
11 SASI_Hs01_00016296 predicted 647
12 SASI_Hs01_00016298 predicted 635
13 SASI_Hs01_00016303 predicted 680
14 SASI_Hs01_00016304 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037488 predicted 270
2 SASI_Rn01_00037489 predicted 373
3 SASI_Rn01_00037490 predicted 216
4 SASI_Rn01_00037491 predicted 342
5 SASI_Rn01_00037492 predicted 281
6 SASI_Rn01_00037493 predicted 328
7 SASI_Rn01_00037494 predicted 267
8 SASI_Rn01_00037495 predicted 340
9 SASI_Rn01_00037496 predicted 311
10 SASI_Rn01_00037497 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172329 predicted 359
2 SASI_Mm01_00172330 predicted 565
3 SASI_Mm01_00172331 predicted 607
4 SASI_Mm02_00318027 predicted 661
5 SASI_Mm01_00172332 predicted 720
6 SASI_Mm01_00172333 predicted 785
7 SASI_Mm01_00172334 predicted 721
8 SASI_Mm01_00172335 predicted 669
9 SASI_Mm01_00172336 predicted 429
10 SASI_Mm01_00172337 predicted 437
11 SASI_Mm01_00172338 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010205
FGF8 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 8 (androgen-induced)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010205.1-1025s1c1
Sequence:CCGGCCCACCCAGCCGGCCGAGGAACTCGAGTTCCTCGGCCGGCTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-368s1c1
Sequence:CCGGGCTGGAAAGAACTTTACAAATCTCGAGATTTGTAAAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-700s1c1
Sequence:CCGGGAAGCTAATTGCCAAGAGCAACTCGAGTTGCTCTTGGCAATTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-667s1c1
Sequence:CCGGGACAGGTCTCTACATCTGCATCTCGAGATGCAGATGTAGAGACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-616s1c1
Sequence:CCGGCATTGTGGAGACCGATACTTTCTCGAGAAAGTATCGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-575s21c1
Sequence:CCGGCATCAACGCCATGGCAGAAGACTCGAGTCTTCTGCCATGGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-925s21c1
Sequence:CCGGTGCGCTTCGAGTTCCTCAACTCTCGAGAGTTGAGGAACTCGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-446s21c1
Sequence:CCGGTAAAGTCACACAGCGACATGTCTCGAGACATGTCGCTGTGTGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010205
FGF8 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 8 (androgen-induced)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010205.1-1025s1c1
Sequence:CCGGCCCACCCAGCCGGCCGAGGAACTCGAGTTCCTCGGCCGGCTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-368s1c1
Sequence:CCGGGCTGGAAAGAACTTTACAAATCTCGAGATTTGTAAAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-700s1c1
Sequence:CCGGGAAGCTAATTGCCAAGAGCAACTCGAGTTGCTCTTGGCAATTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-667s1c1
Sequence:CCGGGACAGGTCTCTACATCTGCATCTCGAGATGCAGATGTAGAGACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-616s1c1
Sequence:CCGGCATTGTGGAGACCGATACTTTCTCGAGAAAGTATCGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-575s21c1
Sequence:CCGGCATCAACGCCATGGCAGAAGACTCGAGTCTTCTGCCATGGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-925s21c1
Sequence:CCGGTGCGCTTCGAGTTCCTCAACTCTCGAGAGTTGAGGAACTCGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-446s21c1
Sequence:CCGGTAAAGTCACACAGCGACATGTCTCGAGACATGTCGCTGTGTGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010205
FGF8 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 8 (androgen-induced)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010205.1-1025s1c1
Sequence:CCGGCCCACCCAGCCGGCCGAGGAACTCGAGTTCCTCGGCCGGCTGGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-368s1c1
Sequence:CCGGGCTGGAAAGAACTTTACAAATCTCGAGATTTGTAAAGTTCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-700s1c1
Sequence:CCGGGAAGCTAATTGCCAAGAGCAACTCGAGTTGCTCTTGGCAATTAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-667s1c1
Sequence:CCGGGACAGGTCTCTACATCTGCATCTCGAGATGCAGATGTAGAGACCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010205.1-616s1c1
Sequence:CCGGCATTGTGGAGACCGATACTTTCTCGAGAAAGTATCGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-575s21c1
Sequence:CCGGCATCAACGCCATGGCAGAAGACTCGAGTCTTCTGCCATGGCGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-925s21c1
Sequence:CCGGTGCGCTTCGAGTTCCTCAACTCTCGAGAGTTGAGGAACTCGAAGCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010205.2-446s21c1
Sequence:CCGGTAAAGTCACACAGCGACATGTCTCGAGACATGTCGCTGTGTGACTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006119
FGF8 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 8 (androgen-induced)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-737s1c1
Sequence:CCGGGCGCTTCGAGTTCCTCAACTACTCGAGTAGTTGAGGAACTCGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-223s1c1
Sequence:CCGGTCTGCCTCCAAGCCCAGGTAACTCGAGTTACCTGGGCTTGGAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-485s1c1
Sequence:CCGGCCTCTACATCTGCATGAACAACTCGAGTTGTTCATGCAGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-441s1c1
Sequence:CCGGGACACCTTTGGAAGCAGAGTTCTCGAGAACTCTGCTTCCAAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-245s1c1
Sequence:CCGGTGTTCAGTCCTCACCTAATTTCTCGAGAAATTAGGTGAGGACTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-322s21c1
Sequence:CCGGTCCGGACCTACCAACTCTACACTCGAGTGTAGAGTTGGTAGGTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-676s21c1
Sequence:CCGGAGCGTGAGGTCCACTTCATGACTCGAGTCATGAAGTGGACCTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006119
FGF8 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 8 (androgen-induced)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-737s1c1
Sequence:CCGGGCGCTTCGAGTTCCTCAACTACTCGAGTAGTTGAGGAACTCGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-223s1c1
Sequence:CCGGTCTGCCTCCAAGCCCAGGTAACTCGAGTTACCTGGGCTTGGAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-485s1c1
Sequence:CCGGCCTCTACATCTGCATGAACAACTCGAGTTGTTCATGCAGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-441s1c1
Sequence:CCGGGACACCTTTGGAAGCAGAGTTCTCGAGAACTCTGCTTCCAAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-245s1c1
Sequence:CCGGTGTTCAGTCCTCACCTAATTTCTCGAGAAATTAGGTGAGGACTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-322s21c1
Sequence:CCGGTCCGGACCTACCAACTCTACACTCGAGTGTAGAGTTGGTAGGTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-676s21c1
Sequence:CCGGAGCGTGAGGTCCACTTCATGACTCGAGTCATGAAGTGGACCTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006119
FGF8 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 8 (androgen-induced)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-737s1c1
Sequence:CCGGGCGCTTCGAGTTCCTCAACTACTCGAGTAGTTGAGGAACTCGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-223s1c1
Sequence:CCGGTCTGCCTCCAAGCCCAGGTAACTCGAGTTACCTGGGCTTGGAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-485s1c1
Sequence:CCGGCCTCTACATCTGCATGAACAACTCGAGTTGTTCATGCAGATGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-441s1c1
Sequence:CCGGGACACCTTTGGAAGCAGAGTTCTCGAGAACTCTGCTTCCAAAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006119.2-245s1c1
Sequence:CCGGTGTTCAGTCCTCACCTAATTTCTCGAGAAATTAGGTGAGGACTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-322s21c1
Sequence:CCGGTCCGGACCTACCAACTCTACACTCGAGTGTAGAGTTGGTAGGTCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006119.3-676s21c1
Sequence:CCGGAGCGTGAGGTCCACTTCATGACTCGAGTCATGAAGTGGACCTCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks