EMAIL THIS PAGE TO A FRIEND

FGF9

fibroblast growth factor 9

101 Gene Product Result for
Synonyms: FGF-9 GAF HBFG-9 HBGF-9 SYNS3
UniProtKB ID: P31371, A8K427, Q3SY32
Gene ID:
Human(2254) Summary: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(14180) fibroblast growth factor 9
Rat(25444) fibroblast growth factor 9
chicken(378917) fibroblast growth factor 9 (glia-activating factor)
domestic cat(101084335) fibroblast growth factor 9 (glia-activating factor)
cow(613731) fibroblast growth factor 9
Horse(100050353) fibroblast growth factor 9 (glia-activating factor)
dog(477340) fibroblast growth factor 9 (glia-activating factor)
sheep(101116844) fibroblast growth factor 9 (glia-activating factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300796 Anti-FGF9 antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB1305354 ANTI-FGF9(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
flow cytometry, western blot pricing
F1672 Anti-Fibroblast Growth Factor-9 antibody, Mouse monoclonal clone FG9-77, purified from hybridoma cell culture human, mouse
dot blot, ELISA, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G007 Guvacine hydrochloride ≥97% (NMR), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002010 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU038131 MISSION® esiRNA esiRNA human FGF9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002010 Rosetta Predictions human pricing
NM_012952 Rosetta Predictions rat pricing
NM_013518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209367 predicted 754
2 SASI_Hs01_00209368 predicted 439
3 SASI_Hs02_00333008 predicted 430
4 SASI_Hs01_00209369 predicted 781
5 SASI_Hs01_00209370 predicted 366
6 SASI_Hs01_00209371 predicted 646
7 SASI_Hs01_00209372 predicted 641
8 SASI_Hs01_00209373 predicted 718
9 SASI_Hs01_00209374 predicted 651
10 SASI_Hs01_00209375 predicted 325
11 SASI_Hs01_00209366 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084650 predicted 420
2 SASI_Rn01_00084651 predicted 740
3 SASI_Rn01_00084653 predicted 734
4 SASI_Rn01_00084654 predicted 489
5 SASI_Rn02_00260537 predicted 420
6 SASI_Rn01_00084655 predicted 629
7 SASI_Rn01_00084656 predicted 765
8 SASI_Rn01_00084657 predicted 842
9 SASI_Rn01_00084658 predicted 692
10 SASI_Rn01_00084659 predicted 424
11 SASI_Rn01_00084652 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190181 predicted 812
2 SASI_Mm02_00322200 predicted 944
3 SASI_Mm01_00190183 predicted 702
4 SASI_Mm01_00190184 predicted 846
5 SASI_Mm02_00322201 predicted 951
6 SASI_Mm02_00322202 predicted 986
7 SASI_Mm02_00322203 predicted 945
8 SASI_Mm02_00322204 predicted 389
9 SASI_Mm02_00322205 predicted 574
10 SASI_Mm01_00190187 predicted 757
11 SASI_Mm01_00190182 predicted 583
12 SASI_Mm01_00190185 predicted 568
13 SASI_Mm01_00190186 predicted 579
14 SASI_Mm01_00190188 predicted 574
15 SASI_Mm01_00190189 predicted 544
16 SASI_Mm01_00190190 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013518
FGF9 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013518.4-1050s21c1
Sequence:CCGGTCATGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-952s21c1
Sequence:CCGGTGACAAAGTACCTGAACTATACTCGAGTATAGTTCAGGTACTTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-521s21c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-678s1c1
Sequence:CCGGGCACCAGAAATTTACACATTTCTCGAGAAATGTGTAAATTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-616s1c1
Sequence:CCGGAGGAGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-416s1c1
Sequence:CCGGGCATTCTGGAATTTATCAGTACTCGAGTACTGATAAATTCCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-578s1c1
Sequence:CCGGCCTACTCTTCCAACCTCTATACTCGAGTATAGAGGTTGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-345s1c1
Sequence:CCGGGACTGGATTTCATTTAGAGATCTCGAGATCTCTAAATGAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013518
FGF9 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013518.4-1050s21c1
Sequence:CCGGTCATGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-952s21c1
Sequence:CCGGTGACAAAGTACCTGAACTATACTCGAGTATAGTTCAGGTACTTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-521s21c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-678s1c1
Sequence:CCGGGCACCAGAAATTTACACATTTCTCGAGAAATGTGTAAATTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-616s1c1
Sequence:CCGGAGGAGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-416s1c1
Sequence:CCGGGCATTCTGGAATTTATCAGTACTCGAGTACTGATAAATTCCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-578s1c1
Sequence:CCGGCCTACTCTTCCAACCTCTATACTCGAGTATAGAGGTTGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-345s1c1
Sequence:CCGGGACTGGATTTCATTTAGAGATCTCGAGATCTCTAAATGAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013518
FGF9 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013518.4-1050s21c1
Sequence:CCGGTCATGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-952s21c1
Sequence:CCGGTGACAAAGTACCTGAACTATACTCGAGTATAGTTCAGGTACTTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013518.4-521s21c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-678s1c1
Sequence:CCGGGCACCAGAAATTTACACATTTCTCGAGAAATGTGTAAATTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-616s1c1
Sequence:CCGGAGGAGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-416s1c1
Sequence:CCGGGCATTCTGGAATTTATCAGTACTCGAGTACTGATAAATTCCAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-578s1c1
Sequence:CCGGCCTACTCTTCCAACCTCTATACTCGAGTATAGAGGTTGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013518.1-345s1c1
Sequence:CCGGGACTGGATTTCATTTAGAGATCTCGAGATCTCTAAATGAAATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002010
VALIDATED
FGF9 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002010.2-1517s21c1
Sequence:CCGGTCACGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1094s21c1
Sequence:CCGGGGAAAGACCACAGCCGATTTGCTCGAGCAAATCGGCTGTGGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1277s21c1
Sequence:CCGGCGTACTCATCAAACCTATATACTCGAGTATATAGGTTTGATGAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-411s1c1
Sequence:CCGGCCAATGGTACTATCCAGGGAACTCGAGTTCCCTGGATAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002010.1-770s1c1
Sequence:CCGGCCTGAACTGTATAAGGATATTCTCGAGAATATCCTTATACAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-716s1c1
Sequence:CCGGCGGCACCAGAAATTCACACATCTCGAGATGTGTGAATTTCTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-329s1c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-656s1c1
Sequence:CCGGAGGCGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002010
VALIDATED
FGF9 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002010.2-1517s21c1
Sequence:CCGGTCACGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1094s21c1
Sequence:CCGGGGAAAGACCACAGCCGATTTGCTCGAGCAAATCGGCTGTGGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1277s21c1
Sequence:CCGGCGTACTCATCAAACCTATATACTCGAGTATATAGGTTTGATGAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-411s1c1
Sequence:CCGGCCAATGGTACTATCCAGGGAACTCGAGTTCCCTGGATAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002010.1-770s1c1
Sequence:CCGGCCTGAACTGTATAAGGATATTCTCGAGAATATCCTTATACAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-716s1c1
Sequence:CCGGCGGCACCAGAAATTCACACATCTCGAGATGTGTGAATTTCTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-329s1c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-656s1c1
Sequence:CCGGAGGCGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002010
VALIDATED
FGF9 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002010.2-1517s21c1
Sequence:CCGGTCACGCGGTGGGTTCTTATTGCTCGAGCAATAAGAACCCACCGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1094s21c1
Sequence:CCGGGGAAAGACCACAGCCGATTTGCTCGAGCAAATCGGCTGTGGTCTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002010.2-1277s21c1
Sequence:CCGGCGTACTCATCAAACCTATATACTCGAGTATATAGGTTTGATGAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-411s1c1
Sequence:CCGGCCAATGGTACTATCCAGGGAACTCGAGTTCCCTGGATAGTACCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002010.1-770s1c1
Sequence:CCGGCCTGAACTGTATAAGGATATTCTCGAGAATATCCTTATACAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-716s1c1
Sequence:CCGGCGGCACCAGAAATTCACACATCTCGAGATGTGTGAATTTCTGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-329s1c1
Sequence:CCGGGTCACGGACTTGGATCATTTACTCGAGTAAATGATCCAAGTCCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002010.1-656s1c1
Sequence:CCGGAGGCGATACTATGTTGCATTACTCGAGTAATGCAACATAGTATCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks