EMAIL THIS PAGE TO A FRIEND

FGFBP1

fibroblast growth factor binding protein 1

66 Gene Product Result for
Synonyms: FGF-BP FGF-BP1 FGFBP FGFBP-1 HBP17
UniProtKB ID: Q14512, A8K5J2
Gene ID:
Human(9982) Summary: This gene encodes a secreted fibroblast growth factor carrier protein. The encoded protein plays a critical role in cell proliferation, differentiation and migration by binding to fibroblast growth factors and potentiating their biological effects on target cells. The encoded protein may also play a role in tumor growth as an angiogenic switch molecule, and expression of this gene has been associated with several types of cancer including pancreatic and colorectal adenocarcinoma. A pseudogene of this gene is also located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
Mouse(14181) fibroblast growth factor binding protein 1
Rat(64535) fibroblast growth factor binding protein 1
sheep(101106941) fibroblast growth factor binding protein 1
domestic guinea pig(100726816) fibroblast growth factor binding protein 1
naked mole-rat(101719225) fibroblast growth factor binding protein 1
Zebrafish(799002) fibroblast growth factor binding protein 1
chicken(422826) fibroblast growth factor binding protein 1
cow(281812) fibroblast growth factor binding protein 1
domestic cat(101094417) fibroblast growth factor binding protein 1
dog(488818) fibroblast growth factor binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005130 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008009 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008009 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008009 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005130 Rosetta Predictions human pricing
NM_022603 Rosetta Predictions rat pricing
NM_008009 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339047 predicted 700
2 SASI_Hs01_00154775 predicted 557
3 SASI_Hs01_00154776 predicted 409
4 SASI_Hs01_00154777 predicted 416
5 SASI_Hs02_00339048 predicted 445
6 SASI_Hs01_00154779 predicted 564
7 SASI_Hs01_00154780 predicted 574
8 SASI_Hs01_00154781 predicted 473
9 SASI_Hs01_00154782 predicted 714
10 SASI_Hs01_00154783 predicted 477
11 SASI_Hs01_00154774 predicted 687
12 SASI_Hs01_00154778 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062874 predicted 242
2 SASI_Rn01_00062875 predicted 311
3 SASI_Rn01_00062876 predicted 318
4 SASI_Rn01_00062877 predicted 605
5 SASI_Rn02_00263360 predicted 541
6 SASI_Rn01_00062878 predicted 318
7 SASI_Rn01_00062879 predicted 389
8 SASI_Rn01_00062880 predicted 423
9 SASI_Rn02_00263361 predicted 632
10 SASI_Rn01_00062882 predicted 391
11 SASI_Rn01_00062881 predicted 425
12 SASI_Rn01_00062883 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008009 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166261 predicted 627
2 SASI_Mm01_00166262 predicted 386
3 SASI_Mm01_00166263 predicted 318
4 SASI_Mm01_00166264 predicted 693
5 SASI_Mm01_00166265 predicted 704
6 SASI_Mm01_00166266 predicted 254
7 SASI_Mm01_00166267 predicted 220
8 SASI_Mm01_00166268 predicted 376
9 SASI_Mm01_00166269 predicted 412
10 SASI_Mm01_00166270 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005130
VALIDATED
FGFBP1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor binding protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-340s1c1
Sequence:CCGGCAAGGTTGAGTGCACTCAATTCTCGAGAATTGAGTGCACTCAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-178s1c1
Sequence:CCGGGAAGAATGGACTTCACAGCAACTCGAGTTGCTGTGAAGTCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-422s1c1
Sequence:CCGGGAGAGAGTCTATTGGAAACAACTCGAGTTGTTTCCAATAGACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-265s1c1
Sequence:CCGGCAAAGGCAAGTTTGTCACCAACTCGAGTTGGTGACAAACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005130.2-195s1c1
Sequence:CCGGGCAAAGTGGTCTCAGAACAAACTCGAGTTTGTTCTGAGACCACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-534s1c1
Sequence:CCGGCCAGTCTTAAGCTAGTCAGCTCTCGAGAGCTGACTAGCTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005130.2-751s1c1
Sequence:CCGGGAGCTCTCTCTGCACATTCTTCTCGAGAAGAATGTGCAGAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-544s1c1
Sequence:CCGGGCTAGTCAGCTCCACTCTATTCTCGAGAATAGAGTGGAGCTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-412s1c1
Sequence:CCGGGCTCAAGGATGAGAGAGTCTACTCGAGTAGACTCTCTCATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-191s1c1
Sequence:CCGGCACAGCAAAGTGGTCTCAGAACTCGAGTTCTGAGACCACTTTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005130
VALIDATED
FGFBP1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor binding protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-340s1c1
Sequence:CCGGCAAGGTTGAGTGCACTCAATTCTCGAGAATTGAGTGCACTCAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-178s1c1
Sequence:CCGGGAAGAATGGACTTCACAGCAACTCGAGTTGCTGTGAAGTCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-422s1c1
Sequence:CCGGGAGAGAGTCTATTGGAAACAACTCGAGTTGTTTCCAATAGACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-265s1c1
Sequence:CCGGCAAAGGCAAGTTTGTCACCAACTCGAGTTGGTGACAAACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005130.2-195s1c1
Sequence:CCGGGCAAAGTGGTCTCAGAACAAACTCGAGTTTGTTCTGAGACCACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-534s1c1
Sequence:CCGGCCAGTCTTAAGCTAGTCAGCTCTCGAGAGCTGACTAGCTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005130.2-751s1c1
Sequence:CCGGGAGCTCTCTCTGCACATTCTTCTCGAGAAGAATGTGCAGAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-544s1c1
Sequence:CCGGGCTAGTCAGCTCCACTCTATTCTCGAGAATAGAGTGGAGCTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-412s1c1
Sequence:CCGGGCTCAAGGATGAGAGAGTCTACTCGAGTAGACTCTCTCATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-191s1c1
Sequence:CCGGCACAGCAAAGTGGTCTCAGAACTCGAGTTCTGAGACCACTTTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005130
VALIDATED
FGFBP1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor binding protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-340s1c1
Sequence:CCGGCAAGGTTGAGTGCACTCAATTCTCGAGAATTGAGTGCACTCAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-178s1c1
Sequence:CCGGGAAGAATGGACTTCACAGCAACTCGAGTTGCTGTGAAGTCCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-422s1c1
Sequence:CCGGGAGAGAGTCTATTGGAAACAACTCGAGTTGTTTCCAATAGACTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-265s1c1
Sequence:CCGGCAAAGGCAAGTTTGTCACCAACTCGAGTTGGTGACAAACTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005130.2-195s1c1
Sequence:CCGGGCAAAGTGGTCTCAGAACAAACTCGAGTTTGTTCTGAGACCACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-534s1c1
Sequence:CCGGCCAGTCTTAAGCTAGTCAGCTCTCGAGAGCTGACTAGCTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005130.2-751s1c1
Sequence:CCGGGAGCTCTCTCTGCACATTCTTCTCGAGAAGAATGTGCAGAGAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-544s1c1
Sequence:CCGGGCTAGTCAGCTCCACTCTATTCTCGAGAATAGAGTGGAGCTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005130.2-412s1c1
Sequence:CCGGGCTCAAGGATGAGAGAGTCTACTCGAGTAGACTCTCTCATCCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005130.2-191s1c1
Sequence:CCGGCACAGCAAAGTGGTCTCAGAACTCGAGTTCTGAGACCACTTTGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008009
VALIDATED
FGFBP1 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-226s1c1
Sequence:CCGGGCAGAGAAGCAGGACATCTAACTCGAGTTAGATGTCCTGCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-692s1c1
Sequence:CCGGGCCATTAGAGATCCAGAGTGTCTCGAGACACTCTGGATCTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-392s1c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-898s1c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-507s1c1
Sequence:CCGGGAAAGAGATTTCCAGAGTCTACTCGAGTAGACTCTGGAAATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-392s21c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-228s21c1
Sequence:CCGGAGAGAAGCAGGACATCTAAATCTCGAGATTTAGATGTCCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008009.3-898s21c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-807s21c1
Sequence:CCGGTACAGGCGACATCATGCTAATCTCGAGATTAGCATGATGTCGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-205s21c1
Sequence:CCGGGTTAGGGAAGGCCCAGAATAACTCGAGTTATTCTGGGCCTTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008009
VALIDATED
FGFBP1 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-226s1c1
Sequence:CCGGGCAGAGAAGCAGGACATCTAACTCGAGTTAGATGTCCTGCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-692s1c1
Sequence:CCGGGCCATTAGAGATCCAGAGTGTCTCGAGACACTCTGGATCTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-392s1c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-898s1c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-507s1c1
Sequence:CCGGGAAAGAGATTTCCAGAGTCTACTCGAGTAGACTCTGGAAATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-392s21c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-228s21c1
Sequence:CCGGAGAGAAGCAGGACATCTAAATCTCGAGATTTAGATGTCCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008009.3-898s21c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-807s21c1
Sequence:CCGGTACAGGCGACATCATGCTAATCTCGAGATTAGCATGATGTCGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-205s21c1
Sequence:CCGGGTTAGGGAAGGCCCAGAATAACTCGAGTTATTCTGGGCCTTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008009
VALIDATED
FGFBP1 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-226s1c1
Sequence:CCGGGCAGAGAAGCAGGACATCTAACTCGAGTTAGATGTCCTGCTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-692s1c1
Sequence:CCGGGCCATTAGAGATCCAGAGTGTCTCGAGACACTCTGGATCTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-392s1c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-898s1c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008009.3-507s1c1
Sequence:CCGGGAAAGAGATTTCCAGAGTCTACTCGAGTAGACTCTGGAAATCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-392s21c1
Sequence:CCGGGACTGCCTTAAACACGACAAACTCGAGTTTGTCGTGTTTAAGGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-228s21c1
Sequence:CCGGAGAGAAGCAGGACATCTAAATCTCGAGATTTAGATGTCCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008009.3-898s21c1
Sequence:CCGGCCCACAAGATACATTTCTAATCTCGAGATTAGAAATGTATCTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-807s21c1
Sequence:CCGGTACAGGCGACATCATGCTAATCTCGAGATTAGCATGATGTCGCCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008009.3-205s21c1
Sequence:CCGGGTTAGGGAAGGCCCAGAATAACTCGAGTTATTCTGGGCCTTCCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks