EMAIL THIS PAGE TO A FRIEND

FGFBP2

fibroblast growth factor binding protein 2

20 Gene Product Result for
Synonyms: HBP17RP KSP37
UniProtKB ID: Q9BYJ0
Gene ID:
Human(83888) Summary: This gene encodes a member of the fibroblast growth factor binding protein family. The encoded protein is a serum protein that is selectively secreted by cytotoxic lymphocytes and may be involved in cytotoxic lymphocyte-mediated immunity. An increase in the amount of gene product may be associated with atopic asthma and mild extrinsic asthma.[provided by RefSeq Staff, Oct 2008]
Zebrafish(793049) fibroblast growth factor binding protein 2
chicken(395094) fibroblast growth factor binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031950 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004931 MISSION® esiRNA esiRNA targeting human FGFBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031950 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221692 predicted 449
2 SASI_Hs01_00221693 predicted 883
3 SASI_Hs01_00221694 predicted 401
4 SASI_Hs01_00221695 predicted 271
5 SASI_Hs01_00221696 predicted 440
6 SASI_Hs01_00221697 predicted 343
7 SASI_Hs01_00221698 predicted 827
8 SASI_Hs01_00221699 predicted 888
9 SASI_Hs01_00221700 predicted 827
10 SASI_Hs01_00221701 predicted 809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031950
FGFBP2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor binding protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-781s1c1
Sequence:CCGGCCTGACAGACAACCATCTCTTCTCGAGAAGAGATGGTTGTCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-338s1c1
Sequence:CCGGCCCAAACCTTACTGGAATCAACTCGAGTTGATTCCAGTAAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-844s1c1
Sequence:CCGGGAAGAGAGTTTCTAATCAGATCTCGAGATCTGATTAGAAACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-658s1c1
Sequence:CCGGGAATGAGGAAGCAAAGAAGAACTCGAGTTCTTCTTTGCTTCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-540s1c1
Sequence:CCGGCAGTGAAACTCACAGAAGCAACTCGAGTTGCTTCTGTGAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-544s1c1
Sequence:CCGGGAAACTCACAGAAGCAACACACTCGAGTGTGTTGCTTCTGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-686s1c1
Sequence:CCGGGAACATTGTTGGAAACCCTTCCTCGAGGAAGGGTTTCCAACAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-782s1c1
Sequence:CCGGCTGACAGACAACCATCTCTTTCTCGAGAAAGAGATGGTTGTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-680s1c1
Sequence:CCGGGCCTGGGAACATTGTTGGAAACTCGAGTTTCCAACAATGTTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-718s1c1
Sequence:CCGGCGCCTTTCTCATCAGCTTCTTCTCGAGAAGAAGCTGATGAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-536s1c1
Sequence:CCGGGCCACAGTGAAACTCACAGAACTCGAGTTCTGTGAGTTTCACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031950
FGFBP2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor binding protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-781s1c1
Sequence:CCGGCCTGACAGACAACCATCTCTTCTCGAGAAGAGATGGTTGTCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-338s1c1
Sequence:CCGGCCCAAACCTTACTGGAATCAACTCGAGTTGATTCCAGTAAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-844s1c1
Sequence:CCGGGAAGAGAGTTTCTAATCAGATCTCGAGATCTGATTAGAAACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-658s1c1
Sequence:CCGGGAATGAGGAAGCAAAGAAGAACTCGAGTTCTTCTTTGCTTCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-540s1c1
Sequence:CCGGCAGTGAAACTCACAGAAGCAACTCGAGTTGCTTCTGTGAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-544s1c1
Sequence:CCGGGAAACTCACAGAAGCAACACACTCGAGTGTGTTGCTTCTGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-686s1c1
Sequence:CCGGGAACATTGTTGGAAACCCTTCCTCGAGGAAGGGTTTCCAACAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-782s1c1
Sequence:CCGGCTGACAGACAACCATCTCTTTCTCGAGAAAGAGATGGTTGTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-680s1c1
Sequence:CCGGGCCTGGGAACATTGTTGGAAACTCGAGTTTCCAACAATGTTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-718s1c1
Sequence:CCGGCGCCTTTCTCATCAGCTTCTTCTCGAGAAGAAGCTGATGAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-536s1c1
Sequence:CCGGGCCACAGTGAAACTCACAGAACTCGAGTTCTGTGAGTTTCACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031950
FGFBP2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor binding protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-781s1c1
Sequence:CCGGCCTGACAGACAACCATCTCTTCTCGAGAAGAGATGGTTGTCTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-338s1c1
Sequence:CCGGCCCAAACCTTACTGGAATCAACTCGAGTTGATTCCAGTAAGGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-844s1c1
Sequence:CCGGGAAGAGAGTTTCTAATCAGATCTCGAGATCTGATTAGAAACTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-658s1c1
Sequence:CCGGGAATGAGGAAGCAAAGAAGAACTCGAGTTCTTCTTTGCTTCCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-540s1c1
Sequence:CCGGCAGTGAAACTCACAGAAGCAACTCGAGTTGCTTCTGTGAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-544s1c1
Sequence:CCGGGAAACTCACAGAAGCAACACACTCGAGTGTGTTGCTTCTGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-686s1c1
Sequence:CCGGGAACATTGTTGGAAACCCTTCCTCGAGGAAGGGTTTCCAACAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164308    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031950.2-782s1c1
Sequence:CCGGCTGACAGACAACCATCTCTTTCTCGAGAAAGAGATGGTTGTCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-680s1c1
Sequence:CCGGGCCTGGGAACATTGTTGGAAACTCGAGTTTCCAACAATGTTCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-718s1c1
Sequence:CCGGCGCCTTTCTCATCAGCTTCTTCTCGAGAAGAAGCTGATGAGAAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031950.2-536s1c1
Sequence:CCGGGCCACAGTGAAACTCACAGAACTCGAGTTCTGTGAGTTTCACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks