EMAIL THIS PAGE TO A FRIEND

FGFBP3

fibroblast growth factor binding protein 3

89 Gene Product Result for
Synonyms: C10orf13 FGF-BP3
UniProtKB ID: Q8TAT2, B2RD68, Q8NBN0
Gene ID:
Mouse(72514) fibroblast growth factor binding protein 3
Rat(499349) fibroblast growth factor binding protein 3
chicken(101667998) fibroblast growth factor binding protein 3
dog(608068) fibroblast growth factor binding protein 3
cow(615980) fibroblast growth factor binding protein 3
chicken(101751656) fibroblast growth factor binding protein 3
domestic guinea pig(100722942) fibroblast growth factor binding protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029761 MISSION® esiRNA esiRNA human FGFBP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152429 Rosetta Predictions human pricing
NM_001109165 Rosetta Predictions rat pricing
NM_028263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049964 predicted 874
2 SASI_Hs01_00049965 predicted 1119
3 SASI_Hs01_00049966 predicted 904
4 SASI_Hs01_00049967 predicted 1076
5 SASI_Hs01_00049968 predicted 1195
6 SASI_Hs01_00049969 predicted 905
7 SASI_Hs01_00049970 predicted 1121
8 SASI_Hs01_00049971 predicted 1314
9 SASI_Hs01_00049972 predicted 1069
10 SASI_Hs01_00049973 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245770 predicted 1346
2 SASI_Rn02_00245771 predicted 1338
3 SASI_Rn02_00245772 predicted 822
4 SASI_Rn02_00245773 predicted 1307
5 SASI_Rn02_00245774 predicted 1326
6 SASI_Rn02_00245775 predicted 1372
7 SASI_Rn02_00245776 predicted 1370
8 SASI_Rn02_00245777 predicted 1026
9 SASI_Rn02_00245778 predicted 1180
10 SASI_Rn02_00245779 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082349 predicted 735
2 SASI_Mm01_00082342 predicted 247
3 SASI_Mm01_00082343 predicted 771
4 SASI_Mm01_00082344 predicted 653
5 SASI_Mm01_00082345 predicted 789
6 SASI_Mm01_00082346 predicted 782
7 SASI_Mm01_00082341 predicted 1255
8 SASI_Mm01_00082347 predicted 1193
9 SASI_Mm01_00082348 predicted 1244
10 SASI_Mm01_00082350 predicted 1144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028263
FGFBP3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-794s1c1
Sequence:CCGGGAAGTGGCATTCCCTTTGCAACTCGAGTTGCAAAGGGAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028263.1-1412s1c1
Sequence:CCGGGACTGGATTATCAGGACAATTCTCGAGAATTGTCCTGATAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-806s1c1
Sequence:CCGGCCTTTGCAACTTCTTTGTCAACTCGAGTTGACAAAGAAGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-811s1c1
Sequence:CCGGGCAACTTCTTTGTCAACTTCTCTCGAGAGAAGTTGACAAAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-800s1c1
Sequence:CCGGGCATTCCCTTTGCAACTTCTTCTCGAGAAGAAGTTGCAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028263
FGFBP3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-794s1c1
Sequence:CCGGGAAGTGGCATTCCCTTTGCAACTCGAGTTGCAAAGGGAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028263.1-1412s1c1
Sequence:CCGGGACTGGATTATCAGGACAATTCTCGAGAATTGTCCTGATAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-806s1c1
Sequence:CCGGCCTTTGCAACTTCTTTGTCAACTCGAGTTGACAAAGAAGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-811s1c1
Sequence:CCGGGCAACTTCTTTGTCAACTTCTCTCGAGAGAAGTTGACAAAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-800s1c1
Sequence:CCGGGCATTCCCTTTGCAACTTCTTCTCGAGAAGAAGTTGCAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028263
FGFBP3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-794s1c1
Sequence:CCGGGAAGTGGCATTCCCTTTGCAACTCGAGTTGCAAAGGGAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028263.1-1412s1c1
Sequence:CCGGGACTGGATTATCAGGACAATTCTCGAGAATTGTCCTGATAATCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-806s1c1
Sequence:CCGGCCTTTGCAACTTCTTTGTCAACTCGAGTTGACAAAGAAGTTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-811s1c1
Sequence:CCGGGCAACTTCTTTGTCAACTTCTCTCGAGAGAAGTTGACAAAGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028263.1-800s1c1
Sequence:CCGGGCATTCCCTTTGCAACTTCTTCTCGAGAAGAAGTTGCAAAGGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152429
FGFBP3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor binding protein 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1545s1c1
Sequence:CCGGGCAGAATGATTTCCTTTCCATCTCGAGATGGAAAGGAAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1381s1c1
Sequence:CCGGGCCAGGTTGAATCAATGTCTTCTCGAGAAGACATTGATTCAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1760s1c1
Sequence:CCGGGCACTTGGCTTAGAAGTGCTACTCGAGTAGCACTTCTAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1696s1c1
Sequence:CCGGCTCACATCTTAGCCTCCAGAACTCGAGTTCTGGAGGCTAAGATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1439s1c1
Sequence:CCGGCCGTTTCTGAATTGGTATAAACTCGAGTTTATACCAATTCAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1142s21c1
Sequence:CCGGTGGGATAGCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1336s21c1
Sequence:CCGGGGATGCAATGTTTATTGTTTACTCGAGTAAACAATAAACATTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152429.4-927s21c1
Sequence:CCGGTGCAACTTCTTTGTCAATTTCCTCGAGGAAATTGACAAAGAAGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152429
FGFBP3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor binding protein 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1545s1c1
Sequence:CCGGGCAGAATGATTTCCTTTCCATCTCGAGATGGAAAGGAAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1381s1c1
Sequence:CCGGGCCAGGTTGAATCAATGTCTTCTCGAGAAGACATTGATTCAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1760s1c1
Sequence:CCGGGCACTTGGCTTAGAAGTGCTACTCGAGTAGCACTTCTAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1696s1c1
Sequence:CCGGCTCACATCTTAGCCTCCAGAACTCGAGTTCTGGAGGCTAAGATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1439s1c1
Sequence:CCGGCCGTTTCTGAATTGGTATAAACTCGAGTTTATACCAATTCAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1142s21c1
Sequence:CCGGTGGGATAGCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1336s21c1
Sequence:CCGGGGATGCAATGTTTATTGTTTACTCGAGTAAACAATAAACATTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152429.4-927s21c1
Sequence:CCGGTGCAACTTCTTTGTCAATTTCCTCGAGGAAATTGACAAAGAAGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152429
FGFBP3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor binding protein 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1545s1c1
Sequence:CCGGGCAGAATGATTTCCTTTCCATCTCGAGATGGAAAGGAAATCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1381s1c1
Sequence:CCGGGCCAGGTTGAATCAATGTCTTCTCGAGAAGACATTGATTCAACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1760s1c1
Sequence:CCGGGCACTTGGCTTAGAAGTGCTACTCGAGTAGCACTTCTAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1696s1c1
Sequence:CCGGCTCACATCTTAGCCTCCAGAACTCGAGTTCTGGAGGCTAAGATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152429.2-1439s1c1
Sequence:CCGGCCGTTTCTGAATTGGTATAAACTCGAGTTTATACCAATTCAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1142s21c1
Sequence:CCGGTGGGATAGCAGAGAAGTTAAACTCGAGTTTAACTTCTCTGCTATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152429.4-1336s21c1
Sequence:CCGGGGATGCAATGTTTATTGTTTACTCGAGTAAACAATAAACATTGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152429.4-927s21c1
Sequence:CCGGTGCAACTTCTTTGTCAATTTCCTCGAGGAAATTGACAAAGAAGTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks