EMAIL THIS PAGE TO A FRIEND

FGFR1OP2

FGFR1 oncogene partner 2

94 Gene Product Result for
Synonyms: HSPC123-like WIT3.0
UniProtKB ID: Q9NVK5, Q6R955, Q8N5L7, Q9P034, Q9UFK8
Gene ID:
Mouse(67529) FGFR1 oncogene partner 2
Rat(362463) FGFR1 oncogene partner 2
sheep(101112552) FGFR1 oncogene partner 2
naked mole-rat(101714142) FGFR1 oncogene partner 2
domestic guinea pig(100717559) FGFR1 oncogene partner 2
Zebrafish(335511) FGFR1 oncogene partner 2
cow(532881) FGFR1 oncogene partner 2
domestic cat(101080804) FGFR1 oncogene partner 2
dog(486626) FGFR1 oncogene partner 2
chicken(418214) FGFR1 oncogene partner 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015633 Rosetta Predictions human pricing
NM_201421 Rosetta Predictions rat pricing
NM_026218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119227 predicted 748
2 SASI_Hs01_00119229 predicted 765
3 SASI_Hs02_00348226 predicted 1043
4 SASI_Hs01_00119231 predicted 698
5 SASI_Hs01_00119233 predicted 1099
6 SASI_Hs02_00348227 predicted 1032
7 SASI_Hs02_00348228 predicted 701
8 SASI_Hs01_00119235 predicted 457
9 SASI_Hs02_00348229 predicted 583
10 SASI_Hs02_00348230 predicted 730
11 SASI_Hs01_00119228 predicted 891
12 SASI_Hs01_00119230 predicted 936
13 SASI_Hs01_00119232 predicted 1078
14 SASI_Hs01_00119234 predicted 532
15 SASI_Hs01_00119236 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096553 predicted 705
2 SASI_Rn01_00096554 predicted 635
3 SASI_Rn01_00096555 predicted 925
4 SASI_Rn01_00096556 predicted 674
5 SASI_Rn01_00096557 predicted 723
6 SASI_Rn02_00270318 predicted 1008
7 SASI_Rn01_00096558 predicted 501
8 SASI_Rn01_00096560 predicted 330
9 SASI_Rn01_00096561 predicted 468
10 SASI_Rn01_00096562 predicted 736
11 SASI_Rn01_00096559 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048573 predicted 682
2 SASI_Mm01_00048575 predicted 332
3 SASI_Mm01_00048576 predicted 705
4 SASI_Mm01_00048578 predicted 481
5 SASI_Mm02_00329888 predicted 1104
6 SASI_Mm01_00048579 predicted 447
7 SASI_Mm01_00048580 predicted 686
8 SASI_Mm01_00048582 predicted 516
9 SASI_Mm02_00329889 predicted 449
10 SASI_Mm02_00329890 predicted 355
11 SASI_Mm01_00048574 predicted 636
12 SASI_Mm01_00048577 predicted 1077
13 SASI_Mm01_00048581 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015633
VALIDATED
FGFR1OP2 MISSION shRNA Bacterial Glycerol Stock
FGFR1 oncogene partner 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-645s21c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-601s21c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-522s21c1
Sequence:CCGGGCCACGGTCCACGTTAGTTATCTCGAGATAACTAACGTGGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015633.1-1491s21c1
Sequence:CCGGGAGGATTTGTACGCTAAATTTCTCGAGAAATTTAGCGTACAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-907s1c1
Sequence:CCGGGCCATTGAAATTGACGAGCAACTCGAGTTGCTCGTCAATTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015633.1-1073s1c1
Sequence:CCGGCCAACAGTGATTTGAGTCTGACTCGAGTCAGACTCAAATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015633.1-645s1c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-1077s1c1
Sequence:CCGGCAGTGATTTGAGTCTGAGGAACTCGAGTTCCTCAGACTCAAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-601s1c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-892s1c1
Sequence:CCGGGCAGTAATGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015633.1-1525s1c1
Sequence:CCGGCGTCAAAGTTGATGCAAAGTTCTCGAGAACTTTGCATCAACTTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015633
VALIDATED
FGFR1OP2 MISSION shRNA shRNA Plasmid DNA
FGFR1 oncogene partner 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-645s21c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-601s21c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-522s21c1
Sequence:CCGGGCCACGGTCCACGTTAGTTATCTCGAGATAACTAACGTGGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015633.1-1491s21c1
Sequence:CCGGGAGGATTTGTACGCTAAATTTCTCGAGAAATTTAGCGTACAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-907s1c1
Sequence:CCGGGCCATTGAAATTGACGAGCAACTCGAGTTGCTCGTCAATTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015633.1-1073s1c1
Sequence:CCGGCCAACAGTGATTTGAGTCTGACTCGAGTCAGACTCAAATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015633.1-645s1c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-1077s1c1
Sequence:CCGGCAGTGATTTGAGTCTGAGGAACTCGAGTTCCTCAGACTCAAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-601s1c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-892s1c1
Sequence:CCGGGCAGTAATGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015633.1-1525s1c1
Sequence:CCGGCGTCAAAGTTGATGCAAAGTTCTCGAGAACTTTGCATCAACTTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015633
VALIDATED
FGFR1OP2 MISSION shRNA Lentiviral Transduction Particles
FGFR1 oncogene partner 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-645s21c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-601s21c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015633.1-522s21c1
Sequence:CCGGGCCACGGTCCACGTTAGTTATCTCGAGATAACTAACGTGGACCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015633.1-1491s21c1
Sequence:CCGGGAGGATTTGTACGCTAAATTTCTCGAGAAATTTAGCGTACAAATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-907s1c1
Sequence:CCGGGCCATTGAAATTGACGAGCAACTCGAGTTGCTCGTCAATTTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015633.1-1073s1c1
Sequence:CCGGCCAACAGTGATTTGAGTCTGACTCGAGTCAGACTCAAATCACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015633.1-645s1c1
Sequence:CCGGGAGCAAGTACCGAGAACAAATCTCGAGATTTGTTCTCGGTACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-1077s1c1
Sequence:CCGGCAGTGATTTGAGTCTGAGGAACTCGAGTTCCTCAGACTCAAATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-601s1c1
Sequence:CCGGCGTACATCTCTGGAAGAACATCTCGAGATGTTCTTCCAGAGATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015633.1-892s1c1
Sequence:CCGGGCAGTAATGAGGAAAGCCATTCTCGAGAATGGCTTTCCTCATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015633.1-1525s1c1
Sequence:CCGGCGTCAAAGTTGATGCAAAGTTCTCGAGAACTTTGCATCAACTTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026218
VALIDATED
FGFR1OP2 MISSION shRNA Bacterial Glycerol Stock
FGFR1 oncogene partner 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-1015s21c1
Sequence:CCGGCTATCTGCCTTAGTGACTAACCTCGAGGTTAGTCACTAAGGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-896s21c1
Sequence:CCGGAGGAACAGGAGCGGATATTTCCTCGAGGAAATATCCGCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-648s21c1
Sequence:CCGGGAAAGATGACCCAGGTATAATCTCGAGATTATACCTGGGTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-2601s21c1
Sequence:CCGGGTCTATTGTGAAACGTTATTTCTCGAGAAATAACGTTTCACAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-838s21c1
Sequence:CCGGACCGAGATGGCAGCAGTAATGCTCGAGCATTACTGCTGCCATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026218
VALIDATED
FGFR1OP2 MISSION shRNA shRNA Plasmid DNA
FGFR1 oncogene partner 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-1015s21c1
Sequence:CCGGCTATCTGCCTTAGTGACTAACCTCGAGGTTAGTCACTAAGGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-896s21c1
Sequence:CCGGAGGAACAGGAGCGGATATTTCCTCGAGGAAATATCCGCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-648s21c1
Sequence:CCGGGAAAGATGACCCAGGTATAATCTCGAGATTATACCTGGGTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-2601s21c1
Sequence:CCGGGTCTATTGTGAAACGTTATTTCTCGAGAAATAACGTTTCACAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-838s21c1
Sequence:CCGGACCGAGATGGCAGCAGTAATGCTCGAGCATTACTGCTGCCATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026218
VALIDATED
FGFR1OP2 MISSION shRNA Lentiviral Transduction Particles
FGFR1 oncogene partner 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-1015s21c1
Sequence:CCGGCTATCTGCCTTAGTGACTAACCTCGAGGTTAGTCACTAAGGCAGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-896s21c1
Sequence:CCGGAGGAACAGGAGCGGATATTTCCTCGAGGAAATATCCGCTCCTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-648s21c1
Sequence:CCGGGAAAGATGACCCAGGTATAATCTCGAGATTATACCTGGGTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249682    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026218.2-2601s21c1
Sequence:CCGGGTCTATTGTGAAACGTTATTTCTCGAGAAATAACGTTTCACAATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026218.2-838s21c1
Sequence:CCGGACCGAGATGGCAGCAGTAATGCTCGAGCATTACTGCTGCCATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks