EMAIL THIS PAGE TO A FRIEND

FGFR1OP

FGFR1 oncogene partner

79 Gene Product Result for
Synonyms: FOP
UniProtKB ID: O95684, A8K1D1, B2R705, Q49AI0, Q5R3F6, Q96EW1
Gene ID:
Human(11116) Summary: This gene encodes a largely hydrophilic centrosomal protein that is required for anchoring microtubules to subcellular structures. A t(6;8)(q27;p11) chromosomal translocation, fusing this gene and the fibroblast growth factor receptor 1 (FGFR1) gene, has been found in cases of myeloproliferative disorder. The resulting chimeric protein contains the N-terminal leucine-rich region of this encoded protein fused to the catalytic domain of FGFR1. Alterations in this gene may also be associated with Crohn's disease, Graves' disease, and vitiligo. Alternatively spliced transcript variants that encode different proteins have been identified. [provided by RefSeq, Jul 2013]
Mouse(75296) Fgfr1 oncogene partner
Rat(365103) FGFR1 oncogene partner
Zebrafish(415215) FGFR1 oncogene partner
chicken(421568) FGFR1 oncogene partner
dog(612453) FGFR1 oncogene partner
cow(506246) FGFR1 oncogene partner
domestic cat(101099885) FGFR1 oncogene partner
domestic guinea pig(100728960) FGFR1 oncogene partner
naked mole-rat(101707272) FGFR1 oncogene partner
sheep(101115039) FGFR1 oncogene partner
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007045 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007045 Rosetta Predictions human pricing
NM_194429 Rosetta Predictions human pricing
NM_201230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166214 predicted 1607
2 SASI_Hs01_00166215 predicted 881
3 SASI_Hs01_00166218 predicted 297
4 SASI_Hs01_00166219 predicted 1638
5 SASI_Hs02_00342833 predicted 287
6 SASI_Hs01_00166220 predicted 307
7 SASI_Hs02_00342834 predicted 883
8 SASI_Hs02_00342835 predicted 1606
9 SASI_Hs02_00342836 predicted 299
10 SASI_Hs01_00166221 predicted 313
11 SASI_Hs01_00166216 predicted 1627
12 SASI_Hs01_00166217 predicted 1053
13 SASI_Hs01_00166222 predicted 374
14 SASI_Hs01_00166223 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186617 predicted 1545
2 SASI_Hs01_00186618 predicted 819
3 SASI_Hs01_00186621 predicted 293
4 SASI_Hs01_00186622 predicted 1578
5 SASI_Hs02_00371494 predicted 293
6 SASI_Hs01_00186623 predicted 299
7 SASI_Hs02_00371495 predicted 824
8 SASI_Hs02_00371496 predicted 303
9 SASI_Hs01_00186624 predicted 310
10 SASI_Hs01_00186626 predicted 381
11 SASI_Hs01_00186619 predicted 1574
12 SASI_Hs01_00186620 predicted 993
13 SASI_Hs01_00186625 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176028 predicted 432
2 SASI_Mm01_00176029 predicted 853
3 SASI_Mm01_00176030 predicted 902
4 SASI_Mm01_00176031 predicted 1158
5 SASI_Mm01_00176032 predicted 1187
6 SASI_Mm01_00176033 predicted 1234
7 SASI_Mm01_00176034 predicted 415
8 SASI_Mm01_00176035 predicted 608
9 SASI_Mm01_00176036 predicted 1174
10 SASI_Mm01_00176037 predicted 953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201230
VALIDATED
FGFR1OP MISSION shRNA Bacterial Glycerol Stock
FGFR1 oncogene partner
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-1107s1c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201230.2-2145s1c1
Sequence:CCGGGCGTCTGTAATGTTAAAGTATCTCGAGATACTTTAACATTACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-750s1c1
Sequence:CCGGGTGGAAGGAGATTCTTTCTTTCTCGAGAAAGAAAGAATCTCCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-1691s21c1
Sequence:CCGGGTTAGACCATTACGGTTATATCTCGAGATATAACCGTAATGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-668s21c1
Sequence:CCGGGAGACAAGAATTGCATCTTTCCTCGAGGAAAGATGCAATTCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-284s21c1
Sequence:CCGGGCTAGTCTCGTCGCAGAATTTCTCGAGAAATTCTGCGACGAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-1106s21c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-426s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201230
VALIDATED
FGFR1OP MISSION shRNA shRNA Plasmid DNA
FGFR1 oncogene partner
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-1107s1c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201230.2-2145s1c1
Sequence:CCGGGCGTCTGTAATGTTAAAGTATCTCGAGATACTTTAACATTACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-750s1c1
Sequence:CCGGGTGGAAGGAGATTCTTTCTTTCTCGAGAAAGAAAGAATCTCCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-1691s21c1
Sequence:CCGGGTTAGACCATTACGGTTATATCTCGAGATATAACCGTAATGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-668s21c1
Sequence:CCGGGAGACAAGAATTGCATCTTTCCTCGAGGAAAGATGCAATTCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-284s21c1
Sequence:CCGGGCTAGTCTCGTCGCAGAATTTCTCGAGAAATTCTGCGACGAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-1106s21c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-426s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201230
VALIDATED
FGFR1OP MISSION shRNA Lentiviral Transduction Particles
FGFR1 oncogene partner
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-1107s1c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201230.2-2145s1c1
Sequence:CCGGGCGTCTGTAATGTTAAAGTATCTCGAGATACTTTAACATTACAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201230.2-750s1c1
Sequence:CCGGGTGGAAGGAGATTCTTTCTTTCTCGAGAAAGAAAGAATCTCCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-1691s21c1
Sequence:CCGGGTTAGACCATTACGGTTATATCTCGAGATATAACCGTAATGGTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-668s21c1
Sequence:CCGGGAGACAAGAATTGCATCTTTCCTCGAGGAAAGATGCAATTCTTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201230.4-284s21c1
Sequence:CCGGGCTAGTCTCGTCGCAGAATTTCTCGAGAAATTCTGCGACGAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-1106s21c1
Sequence:CCGGGACGGGAACACCAGTGATAAACTCGAGTTTATCACTGGTGTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201230.4-426s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007045
VALIDATED
FGFR1OP MISSION shRNA Bacterial Glycerol Stock
FGFR1 oncogene partner
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-1585s1c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-596s1c1
Sequence:CCGGCCAAGTAAGATACCAAGGTATCTCGAGATACCTTGGTATCTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-597s1c1
Sequence:CCGGCAAGTAAGATACCAAGGTATACTCGAGTATACCTTGGTATCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-860s1c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-404s1c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-450s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-285s21c1
Sequence:CCGGATACCAAAGACGGTCGTTTAGCTCGAGCTAAACGACCGTCTTTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-404s21c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-860s21c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-1585s21c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007045
VALIDATED
FGFR1OP MISSION shRNA shRNA Plasmid DNA
FGFR1 oncogene partner
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-1585s1c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-596s1c1
Sequence:CCGGCCAAGTAAGATACCAAGGTATCTCGAGATACCTTGGTATCTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-597s1c1
Sequence:CCGGCAAGTAAGATACCAAGGTATACTCGAGTATACCTTGGTATCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-860s1c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-404s1c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-450s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-285s21c1
Sequence:CCGGATACCAAAGACGGTCGTTTAGCTCGAGCTAAACGACCGTCTTTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-404s21c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-860s21c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-1585s21c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007045
VALIDATED
FGFR1OP MISSION shRNA Lentiviral Transduction Particles
FGFR1 oncogene partner
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-1585s1c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-596s1c1
Sequence:CCGGCCAAGTAAGATACCAAGGTATCTCGAGATACCTTGGTATCTTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-597s1c1
Sequence:CCGGCAAGTAAGATACCAAGGTATACTCGAGTATACCTTGGTATCTTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007045.2-860s1c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007045.2-404s1c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-450s21c1
Sequence:CCGGCTGTGGGTGGACCCTTATTATCTCGAGATAATAAGGGTCCACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-285s21c1
Sequence:CCGGATACCAAAGACGGTCGTTTAGCTCGAGCTAAACGACCGTCTTTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-404s21c1
Sequence:CCGGCGAGAGAATTTAGCCCGAGATCTCGAGATCTCGGGCTAAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-860s21c1
Sequence:CCGGCCCATTCCTAAGCCAGAGAAACTCGAGTTTCTCTGGCTTAGGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286956    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007045.2-1585s21c1
Sequence:CCGGGCATGATGAAAGGTGTCAATACTCGAGTATTGACACCTTTCATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks