EMAIL THIS PAGE TO A FRIEND

FGFR2

fibroblast growth factor receptor 2

306 Gene Product Result for
Synonyms: BBDS BEK BFR-1 CD332 CEK3 CFD1 ECT1 JWS K-SAM KGFR TK14 TK25
Gene ID:
Human(2263) Summary: The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
Mouse(14183) fibroblast growth factor receptor 2
Rat(25022) fibroblast growth factor receptor 2
Zebrafish(352940) fibroblast growth factor receptor 2
Horse(100033956) fibroblast growth factor receptor 2
domestic cat(101095198) fibroblast growth factor receptor 2
cow(404193) fibroblast growth factor receptor 2
chicken(396259) fibroblast growth factor receptor 2
dog(415125) fibroblast growth factor receptor 2
domestic guinea pig(100379152) fibroblast growth factor receptor 2
naked mole-rat(101709077) fibroblast growth factor receptor 2
sheep(443548) fibroblast growth factor receptor 2
Domestic Rabbit(100009417) fibroblast growth factor receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500395 Anti-FGFR2 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1412031 ANTI-FGFR2 antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA035305 Anti-FGFR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4500889 Anti-FGFR2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
HPA056562 Anti-FGFR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
F0300 Anti-Fibroblast Growth Factor Receptor-2, Cytoplasmic antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
F6796 Anti-Fibroblast Growth Factor Receptor-2, Extracellular antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0002263M1 Monoclonal Anti-FGFR2 antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403815 Monoclonal Anti-FGFR2 antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP5030 FGFR2 (285-end), active, GST tagged human PRECISIO® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥80% (SDS-PAGE), buffered aqueous glycerol solution human pricing
F9424 Fibroblast Growth Factor Receptor-2α (IIIb)/Fc Chimera human >90% (SDS-PAGE), recombinant, expressed in baculovirus infected Sf21 cells, lyophilized powder human pricing
F9549 Fibroblast Growth Factor Receptor-2α (IIIc)/Fc Chimera human >90% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder human pricing
F9674 Fibroblast Growth Factor Receptor-2β (IIIb)/Fc Chimera human >90% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder human pricing
F9799 Fibroblast Growth Factor Receptor-2β (IIIc)/Fc Chimera human >90% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder human pricing
APREST89783 PrEST Antigen FGFR2 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution New human pricing
APREST79586 PrEST Antigen FGFR2 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST23612 SILuPrEST FGFR2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
F1927 Fibroblast Growth Factor Receptor 2β (IIIb)/Fc Chimera from mouse >90% (SDS-PAGE), recombinant, expressed in baculovirus infected Sf21 cells, lyophilized powder mouse pricing
F2052 Fibroblast Growth Factor Receptor 2β (IIIc)/Fc Chimera from mouse >95% (SDS-PAGE), recombinant, expressed in NSO cells, lyophilized powder mouse pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0428 AQUA Peptide SPHRPILQAGLPAN[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000141 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125631 MISSION® esiRNA esiRNA human FGFR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000141 Rosetta Predictions human pricing
NM_022969 Rosetta Predictions human pricing
NM_022970 Rosetta Predictions human pricing
NM_022974 Rosetta Predictions human pricing
NM_022976 Rosetta Predictions human pricing
NM_001109892 Rosetta Predictions rat pricing
NM_001109893 Rosetta Predictions rat pricing
NM_001109894 Rosetta Predictions rat pricing
NM_001109895 Rosetta Predictions rat pricing
NM_001109896 Rosetta Predictions rat pricing
NM_012712 Rosetta Predictions rat pricing
NM_010207 Rosetta Predictions mouse pricing
NM_201601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221068 predicted 950
2 SASI_Hs01_00221071 predicted 2660
3 SASI_Hs02_00301954 predicted 2902
4 SASI_Hs01_00221074 predicted 1104
5 SASI_Hs02_00301955 predicted 2913
6 SASI_Hs02_00301956 predicted 3183
7 SASI_Hs01_00221075 predicted 883
8 SASI_Hs01_00221076 predicted 2431
9 SASI_Hs02_00301957 predicted 2996
10 SASI_Hs01_00221077 predicted 1203
11 SASI_Hs01_00221069 predicted 2436
12 SASI_Hs01_00221070 predicted 2535
13 SASI_Hs01_00221072 predicted 977
14 SASI_Hs01_00221073 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212071 predicted 903
2 SASI_Hs01_00212072 predicted 2540
3 SASI_Hs01_00212073 predicted 2620
4 SASI_Hs01_00212074 predicted 2860
5 SASI_Hs01_00212075 predicted 1056
6 SASI_Hs01_00212076 predicted 2872
7 SASI_Hs01_00212077 predicted 3138
8 SASI_Hs01_00212078 predicted 838
9 SASI_Hs01_00212079 predicted 2389
10 SASI_Hs01_00212080 predicted 2951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065330 predicted 951
2 SASI_Hs01_00065332 predicted 2670
3 SASI_Hs01_00065333 predicted 2902
4 SASI_Hs01_00065334 predicted 1099
5 SASI_Hs01_00065335 predicted 2920
6 SASI_Hs01_00065336 predicted 3193
7 SASI_Hs01_00065337 predicted 884
8 SASI_Hs01_00065338 predicted 2432
9 SASI_Hs01_00065339 predicted 2994
10 SASI_Hs02_00356250 predicted 1201
11 SASI_Hs01_00065331 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215527 predicted 899
2 SASI_Hs01_00215528 predicted 1723
3 SASI_Hs01_00215529 predicted 2543
4 SASI_Hs01_00215530 predicted 2614
5 SASI_Hs01_00215531 predicted 1604
6 SASI_Hs01_00215532 predicted 1050
7 SASI_Hs01_00215533 predicted 1797
8 SASI_Hs01_00215534 predicted 838
9 SASI_Hs01_00215535 predicted 2383
10 SASI_Hs01_00215536 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166988 predicted 896
2 SASI_Hs01_00166989 predicted 939
3 SASI_Hs01_00166990 predicted 1053
4 SASI_Hs01_00166991 predicted 827
5 SASI_Hs01_00166992 predicted 1148
6 SASI_Hs01_00166993 predicted 1265
7 SASI_Hs01_00166994 predicted 1204
8 SASI_Hs01_00166995 predicted 940
9 SASI_Hs01_00166996 predicted 1535
10 SASI_Hs01_00166997 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250752 predicted 2889
2 SASI_Rn02_00250753 predicted 2029
3 SASI_Rn02_00250754 predicted 2589
4 SASI_Rn02_00250755 predicted 3150
5 SASI_Rn02_00250756 predicted 3067
6 SASI_Rn02_00250757 predicted 2255
7 SASI_Rn02_00250758 predicted 2914
8 SASI_Rn02_00250759 predicted 2930
9 SASI_Rn02_00250760 predicted 2915
10 SASI_Rn02_00250761 predicted 2394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109893 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250762 predicted 2619
2 SASI_Rn02_00250763 predicted 1772
3 SASI_Rn02_00250764 predicted 2320
4 SASI_Rn02_00250765 predicted 2884
5 SASI_Rn02_00250766 predicted 2808
6 SASI_Rn02_00250767 predicted 1987
7 SASI_Rn02_00250768 predicted 2647
8 SASI_Rn02_00250769 predicted 2666
9 SASI_Rn02_00250770 predicted 2648
10 SASI_Rn02_00250771 predicted 2132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250772 predicted 2624
2 SASI_Rn02_00250773 predicted 1764
3 SASI_Rn02_00250774 predicted 2319
4 SASI_Rn02_00250775 predicted 2880
5 SASI_Rn02_00250776 predicted 2799
6 SASI_Rn02_00250777 predicted 1987
7 SASI_Rn02_00250778 predicted 2644
8 SASI_Rn02_00250779 predicted 2665
9 SASI_Rn02_00250780 predicted 2642
10 SASI_Rn02_00250781 predicted 2130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250782 predicted 2544
2 SASI_Rn02_00250783 predicted 1693
3 SASI_Rn02_00250784 predicted 2249
4 SASI_Rn02_00250785 predicted 2810
5 SASI_Rn02_00250786 predicted 2724
6 SASI_Rn02_00250787 predicted 1917
7 SASI_Rn02_00250788 predicted 2571
8 SASI_Rn02_00250789 predicted 2587
9 SASI_Rn02_00250790 predicted 2568
10 SASI_Rn02_00250791 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250792 predicted 2540
2 SASI_Rn02_00250793 predicted 1690
3 SASI_Rn02_00250794 predicted 2243
4 SASI_Rn02_00250795 predicted 2809
5 SASI_Rn02_00250796 predicted 2724
6 SASI_Rn02_00250797 predicted 1912
7 SASI_Rn02_00250798 predicted 2570
8 SASI_Rn02_00250799 predicted 2589
9 SASI_Rn02_00250800 predicted 2568
10 SASI_Rn02_00250801 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260037 predicted 2890
2 SASI_Rn02_00260038 predicted 2030
3 SASI_Rn02_00260039 predicted 2594
4 SASI_Rn02_00260040 predicted 3148
5 SASI_Rn02_00260041 predicted 3076
6 SASI_Rn02_00260042 predicted 2257
7 SASI_Rn02_00260043 predicted 2916
8 SASI_Rn02_00260044 predicted 2935
9 SASI_Rn02_00260045 predicted 2912
10 SASI_Rn02_00260046 predicted 2406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318030 predicted 3058
2 SASI_Mm02_00318031 predicted 3108
3 SASI_Mm01_00142410 predicted 3166
4 SASI_Mm01_00142411 predicted 3134
5 SASI_Mm02_00318032 predicted 3732
6 SASI_Mm02_00318033 predicted 3650
7 SASI_Mm02_00318034 predicted 3466
8 SASI_Mm01_00142412 predicted 3009
9 SASI_Mm02_00318035 predicted 3492
10 SASI_Mm02_00318036 predicted 3513
11 SASI_Mm01_00142408 predicted 2413
12 SASI_Mm01_00142409 predicted 2720
13 SASI_Mm01_00142413 predicted 2593
14 SASI_Mm01_00142414 predicted 2096
15 SASI_Mm01_00142415 predicted 2557
16 SASI_Mm01_00142416 predicted 2349
17 SASI_Mm01_00142417 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351607 predicted 2723
2 SASI_Mm02_00351608 predicted 2768
3 SASI_Mm01_00172046 predicted 2821
4 SASI_Mm01_00172047 predicted 2792
5 SASI_Mm02_00351609 predicted 3382
6 SASI_Mm02_00351610 predicted 3308
7 SASI_Mm02_00351611 predicted 3122
8 SASI_Mm01_00172048 predicted 2663
9 SASI_Mm02_00351612 predicted 3150
10 SASI_Mm02_00351613 predicted 3169
11 SASI_Mm01_00172044 predicted 2132
12 SASI_Mm01_00172045 predicted 2446
13 SASI_Mm01_00172049 predicted 2322
14 SASI_Mm01_00172050 predicted 1829
15 SASI_Mm01_00172051 predicted 2285
16 SASI_Mm01_00172052 predicted 2083
17 SASI_Mm01_00172053 predicted 1955
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010207
VALIDATED
FGFR2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1637s1c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010207.1-985s1c1
Sequence:CCGGGCCATCTCATCTGGAGATGATCTCGAGATCATCTCCAGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1209s1c1
Sequence:CCGGGCATCGCATTGGAGGCTATAACTCGAGTTATAGCCTCCAATGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-2548s1c1
Sequence:CCGGGCCAGGGATATCAACAACATACTCGAGTATGTTGTTGATATCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2975s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2255s21c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010207.2-2345s21c1
Sequence:CCGGATTATCTGGAGATAGCTATTTCTCGAGAAATAGCTATCTCCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-1828s21c1
Sequence:CCGGCATCGCATTGGAGGCTATAAGCTCGAGCTTATAGCCTCCAATGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010207.2-3794s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010207
VALIDATED
FGFR2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1637s1c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010207.1-985s1c1
Sequence:CCGGGCCATCTCATCTGGAGATGATCTCGAGATCATCTCCAGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1209s1c1
Sequence:CCGGGCATCGCATTGGAGGCTATAACTCGAGTTATAGCCTCCAATGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-2548s1c1
Sequence:CCGGGCCAGGGATATCAACAACATACTCGAGTATGTTGTTGATATCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2975s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2255s21c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010207.2-2345s21c1
Sequence:CCGGATTATCTGGAGATAGCTATTTCTCGAGAAATAGCTATCTCCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-1828s21c1
Sequence:CCGGCATCGCATTGGAGGCTATAAGCTCGAGCTTATAGCCTCCAATGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010207.2-3794s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010207
VALIDATED
FGFR2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1637s1c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010207.1-985s1c1
Sequence:CCGGGCCATCTCATCTGGAGATGATCTCGAGATCATCTCCAGATGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-1209s1c1
Sequence:CCGGGCATCGCATTGGAGGCTATAACTCGAGTTATAGCCTCCAATGCGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010207.1-2548s1c1
Sequence:CCGGGCCAGGGATATCAACAACATACTCGAGTATGTTGTTGATATCCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2975s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-2255s21c1
Sequence:CCGGCGGGTAATTCTATCGGGATATCTCGAGATATCCCGATAGAATTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010207.2-2345s21c1
Sequence:CCGGATTATCTGGAGATAGCTATTTCTCGAGAAATAGCTATCTCCAGATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010207.2-1828s21c1
Sequence:CCGGCATCGCATTGGAGGCTATAAGCTCGAGCTTATAGCCTCCAATGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010207.2-3794s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000141
VALIDATED
FGFR2 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-2910s1c1
Sequence:CCGGGCCAACCTCTCGAACAGTATTCTCGAGAATACTGTTCGAGAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000141.x-3402s1c1
Sequence:CCGGGCACACACTTACAGAGCACAACTCGAGTTGTGCTCTGTAAGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-833s1c1
Sequence:CCGGCCCAACAATAGGACAGTGCTTCTCGAGAAGCACTGTCCTATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-1786s1c1
Sequence:CCGGCCGAATGAAGAACACGACCAACTCGAGTTGGTCGTGTTCTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-703s1c1
Sequence:CCGGGCCACCAACCAAATACCAAATCTCGAGATTTGGTATTTGGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-1623s1c1
Sequence:CCGGGTTCTCTATATTCGGAATGTACTCGAGTACATTCCGAATATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000141.3-4417s1c1
Sequence:CCGGCGTTGTTCCTTCTGTACTAAACTCGAGTTTAGTACAGAAGGAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-989s1c1
Sequence:CCGGCAGTGAAACTTGGTACTTCATCTCGAGATGAAGTACCAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-2666s21c1
Sequence:GTACCGGAGCCCTGTTTGATAGAGTATACTCGAGTATACTCTATCAAACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-2398s1c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-726s1c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-3214s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-849s21c1
Sequence:CCGGGCCGTGATCAGTTGGACTAAGCTCGAGCTTAGTCCAACTGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-726s21c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-2398s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000141
VALIDATED
FGFR2 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-2910s1c1
Sequence:CCGGGCCAACCTCTCGAACAGTATTCTCGAGAATACTGTTCGAGAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000141.x-3402s1c1
Sequence:CCGGGCACACACTTACAGAGCACAACTCGAGTTGTGCTCTGTAAGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-833s1c1
Sequence:CCGGCCCAACAATAGGACAGTGCTTCTCGAGAAGCACTGTCCTATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-1786s1c1
Sequence:CCGGCCGAATGAAGAACACGACCAACTCGAGTTGGTCGTGTTCTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-703s1c1
Sequence:CCGGGCCACCAACCAAATACCAAATCTCGAGATTTGGTATTTGGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-1623s1c1
Sequence:CCGGGTTCTCTATATTCGGAATGTACTCGAGTACATTCCGAATATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000141.3-4417s1c1
Sequence:CCGGCGTTGTTCCTTCTGTACTAAACTCGAGTTTAGTACAGAAGGAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-989s1c1
Sequence:CCGGCAGTGAAACTTGGTACTTCATCTCGAGATGAAGTACCAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-2666s21c1
Sequence:GTACCGGAGCCCTGTTTGATAGAGTATACTCGAGTATACTCTATCAAACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-2398s1c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-726s1c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-3214s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-849s21c1
Sequence:CCGGGCCGTGATCAGTTGGACTAAGCTCGAGCTTAGTCCAACTGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-726s21c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-2398s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000141
VALIDATED
FGFR2 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-2910s1c1
Sequence:CCGGGCCAACCTCTCGAACAGTATTCTCGAGAATACTGTTCGAGAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000366    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000141.x-3402s1c1
Sequence:CCGGGCACACACTTACAGAGCACAACTCGAGTTGTGCTCTGTAAGTGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-833s1c1
Sequence:CCGGCCCAACAATAGGACAGTGCTTCTCGAGAAGCACTGTCCTATTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-1786s1c1
Sequence:CCGGCCGAATGAAGAACACGACCAACTCGAGTTGGTCGTGTTCTTCATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000141.x-703s1c1
Sequence:CCGGGCCACCAACCAAATACCAAATCTCGAGATTTGGTATTTGGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-1623s1c1
Sequence:CCGGGTTCTCTATATTCGGAATGTACTCGAGTACATTCCGAATATAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194817    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000141.3-4417s1c1
Sequence:CCGGCGTTGTTCCTTCTGTACTAAACTCGAGTTTAGTACAGAAGGAACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.3-989s1c1
Sequence:CCGGCAGTGAAACTTGGTACTTCATCTCGAGATGAAGTACCAAGTTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-2666s21c1
Sequence:GTACCGGAGCCCTGTTTGATAGAGTATACTCGAGTATACTCTATCAAACAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-2398s1c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000141.4-726s1c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-3214s21c1
Sequence:CCGGATATGGATCAGAGGAGTAAATCTCGAGATTTACTCCTCTGATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-849s21c1
Sequence:CCGGGCCGTGATCAGTTGGACTAAGCTCGAGCTTAGTCCAACTGATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000141.4-726s21c1
Sequence:CCGGTTAGTTGAGGATACCACATTACTCGAGTAATGTGGTATCCTCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000141.4-2398s21c1
Sequence:CCGGTGGAGTACTCCTATGACATTACTCGAGTAATGTCATAGGAGTACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks