EMAIL THIS PAGE TO A FRIEND

FGFR3

fibroblast growth factor receptor 3

95 Gene Product Result for
Synonyms: ACH CD333 CEK2 HSFGFR3EX JTK4
Gene ID:
Human(2261) Summary: This gene encodes a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Jul 2009]
Mouse(14184) fibroblast growth factor receptor 3
Rat(84489) fibroblast growth factor receptor 3
Zebrafish(58129) fibroblast growth factor receptor 3
chicken(396515) fibroblast growth factor receptor 3
cow(281769) fibroblast growth factor receptor 3
Horse(100034114) fibroblast growth factor receptor 3
domestic cat(100141386) fibroblast growth factor receptor 3
dog(488808) fibroblast growth factor receptor 3
sheep(554324) fibroblast growth factor receptor 3
naked mole-rat(101711651) fibroblast growth factor receptor 3
domestic guinea pig(100732948) fibroblast growth factor receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000142 Rosetta Predictions human pricing
NM_022965 Rosetta Predictions human pricing
NM_053429 Rosetta Predictions rat pricing
NM_008010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154694 predicted 2405
2 SASI_Hs01_00154695 predicted 2242
3 SASI_Hs01_00154696 predicted 466
4 SASI_Hs01_00154697 predicted 860
5 SASI_Hs01_00154698 predicted 598
6 SASI_Hs01_00154699 predicted 2393
7 SASI_Hs01_00154700 predicted 957
8 SASI_Hs01_00154701 predicted 809
9 SASI_Hs01_00154702 predicted 2381
10 SASI_Hs01_00154703 predicted 2510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120986 predicted 2073
2 SASI_Hs01_00120987 predicted 1908
3 SASI_Hs01_00120988 predicted 467
4 SASI_Hs01_00120989 predicted 854
5 SASI_Hs01_00120990 predicted 600
6 SASI_Hs01_00120991 predicted 2053
7 SASI_Hs01_00120992 predicted 952
8 SASI_Hs01_00120993 predicted 814
9 SASI_Hs01_00120994 predicted 2052
10 SASI_Hs01_00120995 predicted 2172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073505 predicted 2140
2 SASI_Rn02_00265981 predicted 1249
3 SASI_Rn01_00073506 predicted 2193
4 SASI_Rn01_00073507 predicted 581
5 SASI_Rn01_00073509 predicted 1895
6 SASI_Rn01_00073510 predicted 2234
7 SASI_Rn01_00073511 predicted 1934
8 SASI_Rn01_00073512 predicted 1331
9 SASI_Rn01_00073513 predicted 1507
10 SASI_Rn02_00265982 predicted 1913
11 SASI_Rn01_00073508 predicted 1874
12 SASI_Rn01_00073514 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078415 predicted 2447
2 SASI_Mm01_00078416 predicted 1556
3 SASI_Mm01_00078417 predicted 953
4 SASI_Mm01_00078418 predicted 2805
5 SASI_Mm01_00078419 predicted 890
6 SASI_Mm01_00078420 predicted 2169
7 SASI_Mm01_00078421 predicted 1380
8 SASI_Mm01_00078422 predicted 650
9 SASI_Mm01_00078423 predicted 1636
10 SASI_Mm01_00078424 predicted 1559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000142
FGFR3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-605s21c1
Sequence:CCGGGTACTGTGCCACTTCAGTGTGCTCGAGCACACTGAAGTGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1072s21c1
Sequence:CCGGGTTCCACTGCAAGGTGTACAGCTCGAGCTGTACACCTTGCAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1208s21c1
Sequence:CCGGGACAAGGAGCTAGAGGTTCTCCTCGAGGAGAACCTCTAGCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-808s21c1
Sequence:CCGGCTCCATCTCCTGGCTGAAGAACTCGAGTTCTTCAGCCAGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-862s21c1
Sequence:CCGGAGGCATCAAGCTGCGGCATCACTCGAGTGATGCCGCAGCTTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-885s21c1
Sequence:CCGGAGTGGAGCCTGGTCATGGAAACTCGAGTTTCCATGACCAGGCTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1761s1c1
Sequence:CCGGCCTGGACTACTCCTTCGACACCTCGAGGTGTCGAAGGAGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1926s1c1
Sequence:CCGGCGTGATGAAGATCGCAGACTTCTCGAGAAGTCTGCGATCTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000142.2-3510s1c1
Sequence:CCGGGTGATTCCAGTGAAGATATTTCTCGAGAAATATCTTCACTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-730s1c1
Sequence:CCGGGAGAACAAGTTTGGCAGCATCCTCGAGGATGCTGCCAAACTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1568s1c1
Sequence:CCGGTGAAAGACGATGCCACTGACACTCGAGTGTCAGTGGCATCGTCTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1972s1c1
Sequence:CCGGCTCGACTACTACAAGAAGACACTCGAGTGTCTTCTTGTAGTAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1965s1c1
Sequence:CCGGGCACAACCTCGACTACTACAACTCGAGTTGTAGTAGTCGAGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000142.x-3699s1c1
Sequence:CCGGGTTCCGATGTTATTAGATGTTCTCGAGAACATCTAATAACATCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-721s1c1
Sequence:CCGGTGCGTCGTGGAGAACAAGTTTCTCGAGAAACTTGTTCTCCACGACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000142
FGFR3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-605s21c1
Sequence:CCGGGTACTGTGCCACTTCAGTGTGCTCGAGCACACTGAAGTGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1072s21c1
Sequence:CCGGGTTCCACTGCAAGGTGTACAGCTCGAGCTGTACACCTTGCAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1208s21c1
Sequence:CCGGGACAAGGAGCTAGAGGTTCTCCTCGAGGAGAACCTCTAGCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-808s21c1
Sequence:CCGGCTCCATCTCCTGGCTGAAGAACTCGAGTTCTTCAGCCAGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-862s21c1
Sequence:CCGGAGGCATCAAGCTGCGGCATCACTCGAGTGATGCCGCAGCTTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-885s21c1
Sequence:CCGGAGTGGAGCCTGGTCATGGAAACTCGAGTTTCCATGACCAGGCTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1761s1c1
Sequence:CCGGCCTGGACTACTCCTTCGACACCTCGAGGTGTCGAAGGAGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1926s1c1
Sequence:CCGGCGTGATGAAGATCGCAGACTTCTCGAGAAGTCTGCGATCTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000142.2-3510s1c1
Sequence:CCGGGTGATTCCAGTGAAGATATTTCTCGAGAAATATCTTCACTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-730s1c1
Sequence:CCGGGAGAACAAGTTTGGCAGCATCCTCGAGGATGCTGCCAAACTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1568s1c1
Sequence:CCGGTGAAAGACGATGCCACTGACACTCGAGTGTCAGTGGCATCGTCTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1972s1c1
Sequence:CCGGCTCGACTACTACAAGAAGACACTCGAGTGTCTTCTTGTAGTAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1965s1c1
Sequence:CCGGGCACAACCTCGACTACTACAACTCGAGTTGTAGTAGTCGAGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000142.x-3699s1c1
Sequence:CCGGGTTCCGATGTTATTAGATGTTCTCGAGAACATCTAATAACATCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-721s1c1
Sequence:CCGGTGCGTCGTGGAGAACAAGTTTCTCGAGAAACTTGTTCTCCACGACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000142
FGFR3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-605s21c1
Sequence:CCGGGTACTGTGCCACTTCAGTGTGCTCGAGCACACTGAAGTGGCACAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1072s21c1
Sequence:CCGGGTTCCACTGCAAGGTGTACAGCTCGAGCTGTACACCTTGCAGTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-1208s21c1
Sequence:CCGGGACAAGGAGCTAGAGGTTCTCCTCGAGGAGAACCTCTAGCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-808s21c1
Sequence:CCGGCTCCATCTCCTGGCTGAAGAACTCGAGTTCTTCAGCCAGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-862s21c1
Sequence:CCGGAGGCATCAAGCTGCGGCATCACTCGAGTGATGCCGCAGCTTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000142.4-885s21c1
Sequence:CCGGAGTGGAGCCTGGTCATGGAAACTCGAGTTTCCATGACCAGGCTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1761s1c1
Sequence:CCGGCCTGGACTACTCCTTCGACACCTCGAGGTGTCGAAGGAGTAGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-1926s1c1
Sequence:CCGGCGTGATGAAGATCGCAGACTTCTCGAGAAGTCTGCGATCTTCATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000142.2-3510s1c1
Sequence:CCGGGTGATTCCAGTGAAGATATTTCTCGAGAAATATCTTCACTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000142.2-730s1c1
Sequence:CCGGGAGAACAAGTTTGGCAGCATCCTCGAGGATGCTGCCAAACTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1568s1c1
Sequence:CCGGTGAAAGACGATGCCACTGACACTCGAGTGTCAGTGGCATCGTCTTTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1972s1c1
Sequence:CCGGCTCGACTACTACAAGAAGACACTCGAGTGTCTTCTTGTAGTAGTCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-1965s1c1
Sequence:CCGGGCACAACCTCGACTACTACAACTCGAGTTGTAGTAGTCGAGGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000142.x-3699s1c1
Sequence:CCGGGTTCCGATGTTATTAGATGTTCTCGAGAACATCTAATAACATCGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000142.x-721s1c1
Sequence:CCGGTGCGTCGTGGAGAACAAGTTTCTCGAGAAACTTGTTCTCCACGACGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008010
FGFR3 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008010.4-2829s21c1
Sequence:CCGGACAAGACTTCCTGCGTGTTTACTCGAGTAAACACGCAGGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-949s21c1
Sequence:CCGGCCTCCGATCGTGGCAACTATACTCGAGTATAGTTGCCACGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-1888s21c1
Sequence:CCGGGCAAGCACAAGAACATCATTACTCGAGTAATGATGTTCTTGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-659s21c1
Sequence:CCGGCCACTTCAGTGTGCGTGTAACCTCGAGGTTACACGCACACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-2515s21c1
Sequence:CCGGAGCAGTTGGTAGAGGATTTAGCTCGAGCTAAATCCTCTACCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-1311s1c1
Sequence:CCGGGCGGGCAATTCTATTGGGTTTCTCGAGAAACCCAATAGAATTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-658s1c1
Sequence:CCGGGCCACTTCAGTGTGCGTGTAACTCGAGTTACACGCACACTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008010
FGFR3 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008010.4-2829s21c1
Sequence:CCGGACAAGACTTCCTGCGTGTTTACTCGAGTAAACACGCAGGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-949s21c1
Sequence:CCGGCCTCCGATCGTGGCAACTATACTCGAGTATAGTTGCCACGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-1888s21c1
Sequence:CCGGGCAAGCACAAGAACATCATTACTCGAGTAATGATGTTCTTGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-659s21c1
Sequence:CCGGCCACTTCAGTGTGCGTGTAACCTCGAGGTTACACGCACACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-2515s21c1
Sequence:CCGGAGCAGTTGGTAGAGGATTTAGCTCGAGCTAAATCCTCTACCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-1311s1c1
Sequence:CCGGGCGGGCAATTCTATTGGGTTTCTCGAGAAACCCAATAGAATTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-658s1c1
Sequence:CCGGGCCACTTCAGTGTGCGTGTAACTCGAGTTACACGCACACTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008010
FGFR3 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008010.4-2829s21c1
Sequence:CCGGACAAGACTTCCTGCGTGTTTACTCGAGTAAACACGCAGGAAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-949s21c1
Sequence:CCGGCCTCCGATCGTGGCAACTATACTCGAGTATAGTTGCCACGATCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-1888s21c1
Sequence:CCGGGCAAGCACAAGAACATCATTACTCGAGTAATGATGTTCTTGTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-659s21c1
Sequence:CCGGCCACTTCAGTGTGCGTGTAACCTCGAGGTTACACGCACACTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008010.4-2515s21c1
Sequence:CCGGAGCAGTTGGTAGAGGATTTAGCTCGAGCTAAATCCTCTACCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-1311s1c1
Sequence:CCGGGCGGGCAATTCTATTGGGTTTCTCGAGAAACCCAATAGAATTGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008010.1-658s1c1
Sequence:CCGGGCCACTTCAGTGTGCGTGTAACTCGAGTTACACGCACACTGAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks