EMAIL THIS PAGE TO A FRIEND

FGFR4

fibroblast growth factor receptor 4

110 Gene Product Result for
Synonyms: CD334 JTK2 TKF
UniProtKB ID: P22455, O43785, Q14309, Q71TW8, Q8TDA0
Gene ID:
Human(2264) Summary: The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(14186) fibroblast growth factor receptor 4
Rat(25114) fibroblast growth factor receptor 4
Zebrafish(100000160) fibroblast growth factor receptor 4
dog(489095) fibroblast growth factor receptor 4
cow(317696) fibroblast growth factor receptor 4
Horse(100068679) fibroblast growth factor receptor 4
domestic cat(101100864) fibroblast growth factor receptor 4
chicken(395603) fibroblast growth factor receptor 4
sheep(101120660) fibroblast growth factor receptor 4
Domestic Rabbit(100355275) fibroblast growth factor receptor 4
domestic guinea pig(100733523) fibroblast growth factor receptor 4
naked mole-rat(101700214) fibroblast growth factor receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300019 Anti-FGFR4 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300886 Anti-FGFR4 antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, western blot pricing
HPA027273 Anti-FGFR4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA027369 Anti-FGFR4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry pricing
HPA028251 Anti-FGFR4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human, mouse
immunohistochemistry, western blot pricing
SAB4300637 Anti-FGFR4 antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
SAB4301393 Anti-phospho-FGFR4 (pTyr642) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1300137 Monoclonal Anti-FGFR4 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
SAB5300467 Monoclonal Anti-FGFR4 antibody produced in mouse clone 4H2B10B2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300468 Monoclonal Anti-FGFR4 antibody produced in mouse clone 7H1, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB1402195 Monoclonal Anti-FGFR4 antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0428 AQUA Peptide SPHRPILQAGLPAN[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002011 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002011 Rosetta Predictions human pricing
NM_022963 Rosetta Predictions human pricing
NM_213647 Rosetta Predictions human pricing
NM_001109904 Rosetta Predictions rat pricing
NM_008011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130921 predicted 490
2 SASI_Hs01_00130922 predicted 2592
3 SASI_Hs01_00130923 predicted 2640
4 SASI_Hs01_00130924 predicted 865
5 SASI_Hs01_00130925 predicted 2523
6 SASI_Hs01_00130926 predicted 2433
7 SASI_Hs01_00130927 predicted 1974
8 SASI_Hs01_00130928 predicted 757
9 SASI_Hs01_00130929 predicted 2138
10 SASI_Hs01_00130930 predicted 2036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205665 predicted 374
2 SASI_Hs01_00205666 predicted 2356
3 SASI_Hs01_00205667 predicted 2406
4 SASI_Hs01_00205668 predicted 754
5 SASI_Hs01_00205669 predicted 2289
6 SASI_Hs01_00205670 predicted 2205
7 SASI_Hs01_00205671 predicted 1740
8 SASI_Hs01_00205672 predicted 645
9 SASI_Hs01_00205673 predicted 1904
10 SASI_Hs01_00205674 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031738 predicted 536
2 SASI_Hs01_00031739 predicted 2638
3 SASI_Hs01_00031740 predicted 2684
4 SASI_Hs01_00031741 predicted 908
5 SASI_Hs01_00031742 predicted 2565
6 SASI_Hs01_00031743 predicted 2481
7 SASI_Hs01_00031744 predicted 2019
8 SASI_Hs01_00031745 predicted 800
9 SASI_Hs01_00031746 predicted 2189
10 SASI_Hs01_00031747 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250842 predicted 1263
2 SASI_Rn02_00250843 predicted 2142
3 SASI_Rn02_00250844 predicted 2036
4 SASI_Rn02_00250845 predicted 1033
5 SASI_Rn02_00250846 predicted 513
6 SASI_Rn02_00250847 predicted 1269
7 SASI_Rn02_00250848 predicted 843
8 SASI_Rn02_00250849 predicted 2351
9 SASI_Rn02_00250850 predicted 2588
10 SASI_Rn02_00250851 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030449 predicted 1717
2 SASI_Mm01_00030450 predicted 509
3 SASI_Mm01_00030451 predicted 2060
4 SASI_Mm01_00030452 predicted 2334
5 SASI_Mm01_00030454 predicted 825
6 SASI_Mm01_00030455 predicted 2025
7 SASI_Mm02_00312948 predicted 1077
8 SASI_Mm01_00030458 predicted 1998
9 SASI_Mm02_00312949 predicted 1251
10 SASI_Mm02_00312950 predicted 496
11 SASI_Mm01_00030453 predicted 1203
12 SASI_Mm01_00030456 predicted 1769
13 SASI_Mm01_00030457 predicted 2612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008011
VALIDATED
FGFR4 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1007s1c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-2367s1c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-583s1c1
Sequence:CCGGCTGCCGGGAATACTGTCAAATCTCGAGATTTGACAGTATTCCCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1697s1c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008011.1-419s1c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-2398s21c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1728s21c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1065s21c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-477s21c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008011
VALIDATED
FGFR4 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1007s1c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-2367s1c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-583s1c1
Sequence:CCGGCTGCCGGGAATACTGTCAAATCTCGAGATTTGACAGTATTCCCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1697s1c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008011.1-419s1c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-2398s21c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1728s21c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1065s21c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-477s21c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008011
VALIDATED
FGFR4 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1007s1c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-2367s1c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-583s1c1
Sequence:CCGGCTGCCGGGAATACTGTCAAATCTCGAGATTTGACAGTATTCCCGGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008011.1-1697s1c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008011.1-419s1c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-2398s21c1
Sequence:CCGGGCTGTCTCTGAAGAGTACCTTCTCGAGAAGGTACTCTTCAGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1728s21c1
Sequence:CCGGGCTAATCGGAAGACACAAGAACTCGAGTTCTTGTGTCTTCCGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-1065s21c1
Sequence:CCGGCCTGAAGACAACAGACATCAACTCGAGTTGATGTCTGTTGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008011.2-477s21c1
Sequence:CCGGCGTCGTACACAATCTTACGTTCTCGAGAACGTAAGATTGTGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002011
FGFR4 MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor receptor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-472s1c1
Sequence:CCGGTCCATGATCGTCCTGCAGAATCTCGAGATTCTGCAGGACGATCATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1739s1c1
Sequence:CCGGGCCGACACAAGAACATCATCACTCGAGTGATGATGTTCTTGTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1055s1c1
Sequence:CCGGCCTATGTGCAAGTCCTAAAGACTCGAGTCTTTAGGACTTGCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-2440s1c1
Sequence:CCGGGCCTGACCTTCGGACCCTATTCTCGAGAATAGGGTCCGAAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2824s1c1
Sequence:CCGGGCTGGAGAGCTGCTATGCTAACTCGAGTTAGCATAGCAGCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2640s1c1
Sequence:CCGGCCTGACACAGTGCTCGACCTTCTCGAGAAGGTCGAGCACTGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-854s1c1
Sequence:CCGGTGTGGGCAGCATCCGCTATAACTCGAGTTATAGCGGATGCTGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-573s1c1
Sequence:CCGGCCCTCGAATAGGCACAGTTACCTCGAGGTAACTGTGCCTATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002011
FGFR4 MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor receptor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-472s1c1
Sequence:CCGGTCCATGATCGTCCTGCAGAATCTCGAGATTCTGCAGGACGATCATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1739s1c1
Sequence:CCGGGCCGACACAAGAACATCATCACTCGAGTGATGATGTTCTTGTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1055s1c1
Sequence:CCGGCCTATGTGCAAGTCCTAAAGACTCGAGTCTTTAGGACTTGCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-2440s1c1
Sequence:CCGGGCCTGACCTTCGGACCCTATTCTCGAGAATAGGGTCCGAAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2824s1c1
Sequence:CCGGGCTGGAGAGCTGCTATGCTAACTCGAGTTAGCATAGCAGCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2640s1c1
Sequence:CCGGCCTGACACAGTGCTCGACCTTCTCGAGAAGGTCGAGCACTGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-854s1c1
Sequence:CCGGTGTGGGCAGCATCCGCTATAACTCGAGTTATAGCGGATGCTGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-573s1c1
Sequence:CCGGCCCTCGAATAGGCACAGTTACCTCGAGGTAACTGTGCCTATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002011
FGFR4 MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor receptor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-472s1c1
Sequence:CCGGTCCATGATCGTCCTGCAGAATCTCGAGATTCTGCAGGACGATCATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1739s1c1
Sequence:CCGGGCCGACACAAGAACATCATCACTCGAGTGATGATGTTCTTGTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002011.x-1055s1c1
Sequence:CCGGCCTATGTGCAAGTCCTAAAGACTCGAGTCTTTAGGACTTGCACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-2440s1c1
Sequence:CCGGGCCTGACCTTCGGACCCTATTCTCGAGAATAGGGTCCGAAGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2824s1c1
Sequence:CCGGGCTGGAGAGCTGCTATGCTAACTCGAGTTAGCATAGCAGCTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002011.3-2640s1c1
Sequence:CCGGCCTGACACAGTGCTCGACCTTCTCGAGAAGGTCGAGCACTGTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-854s1c1
Sequence:CCGGTGTGGGCAGCATCCGCTATAACTCGAGTTATAGCGGATGCTGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002011.3-573s1c1
Sequence:CCGGCCCTCGAATAGGCACAGTTACCTCGAGGTAACTGTGCCTATTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks