EMAIL THIS PAGE TO A FRIEND

FGG

fibrinogen gamma chain

97 Gene Product Result for
Gene ID:
Human(2266) Summary: The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(99571) fibrinogen gamma chain
Rat(24367) fibrinogen gamma chain
Zebrafish(406327) fibrinogen, gamma polypeptide
dog(475474) fibrinogen gamma chain
cow(280792) fibrinogen gamma chain
Horse(100147221) fibrinogen gamma chain
domestic cat(101092680) fibrinogen gamma chain
chicken(395837) fibrinogen gamma chain
Domestic Rabbit(100351591) fibrinogen gamma chain
domestic guinea pig(100720373) fibrinogen gamma chain
naked mole-rat(101696987) fibrinogen gamma chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44300 Anti-FGG antibody produced in rabbit IgG fraction of antiserum zebrafish, guinea pig, rat, horse, pig, human, bovine, canine, mouse, rabbit
western blot pricing
SAB2100816 Anti-FGG antibody produced in rabbit affinity isolated antibody bovine, rat, rabbit, mouse, horse, guinea pig, human, zebrafish
western blot pricing
HPA027529 Anti-FGG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1306587 ANTI-FIBG(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
F8512 Anti-Fibrinogen antibody produced in goat whole antiserum human
ELISA, quantitative precipitin assay pricing
WH0002266M1 Monoclonal Anti-FGG antibody produced in mouse clone 1F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403816 Monoclonal Anti-FGG antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300465 Monoclonal Anti-FGG antibody produced in mouse clone 5A6, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB5300466 Monoclonal Anti-FGG antibody produced in mouse clone 4H9, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
F4639 Monoclonal Anti-Fibrinogen antibody produced in mouse clone FG-21, ascites fluid baboon, human
ELISA pricing
F9902 Monoclonal Anti-Fibrinogen antibody produced in mouse clone 85D4, ascites fluid goat, canine, human, baboon, bovine, pig, rabbit, sheep
dot blot, ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0497 AQUA Peptide ILTHDSSI[R] human pricing
AQ0498 AQUA Peptide GYDNGIIWATW[K] human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000509 Rosetta Predictions human pricing
NM_021870 Rosetta Predictions human pricing
NM_012559 Rosetta Predictions rat pricing
NM_133862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074633 predicted 801
2 SASI_Hs01_00074634 predicted 645
3 SASI_Hs01_00074635 predicted 744
4 SASI_Hs01_00074636 predicted 262
5 SASI_Hs01_00074637 predicted 399
6 SASI_Hs01_00074638 predicted 295
7 SASI_Hs01_00074639 predicted 497
8 SASI_Hs01_00074641 predicted 196
9 SASI_Hs01_00074642 predicted 691
10 SASI_Hs02_00302694 predicted 454
11 SASI_Hs01_00074640 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046178 predicted 807
2 SASI_Hs01_00046179 predicted 644
3 SASI_Hs01_00046180 predicted 739
4 SASI_Hs01_00046181 predicted 257
5 SASI_Hs01_00046182 predicted 406
6 SASI_Hs01_00046183 predicted 293
7 SASI_Hs01_00046184 predicted 499
8 SASI_Hs01_00046186 predicted 193
9 SASI_Hs01_00046187 predicted 694
10 SASI_Hs02_00355148 predicted 455
11 SASI_Hs01_00046185 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074747 predicted 1197
2 SASI_Rn01_00074748 predicted 385
3 SASI_Rn01_00074749 predicted 397
4 SASI_Rn01_00074750 predicted 1167
5 SASI_Rn01_00074751 predicted 714
6 SASI_Rn01_00074752 predicted 1135
7 SASI_Rn01_00074753 predicted 607
8 SASI_Rn01_00074754 predicted 737
9 SASI_Rn01_00074755 predicted 1171
10 SASI_Rn01_00074756 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029690 predicted 387
2 SASI_Mm01_00029691 predicted 698
3 SASI_Mm01_00029692 predicted 267
4 SASI_Mm01_00029693 predicted 655
5 SASI_Mm01_00029694 predicted 220
6 SASI_Mm01_00029695 predicted 692
7 SASI_Mm01_00029696 predicted 676
8 SASI_Mm01_00029697 predicted 377
9 SASI_Mm01_00029698 predicted 508
10 SASI_Mm02_00338920 predicted 589
11 SASI_Mm01_00029699 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133862
FGG MISSION shRNA Bacterial Glycerol Stock
fibrinogen gamma chain
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133862.1-1365s1c1
Sequence:CCGGCCAAGCAGAGAACTATACTATCTCGAGATAGTATAGTTCTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-128s1c1
Sequence:CCGGGATTCGGTAGTTTCTGCCCAACTCGAGTTGGGCAGAAACTACCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-912s1c1
Sequence:CCGGCCTGACCTATGCCTACTTCATCTCGAGATGAAGTAGGCATAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-1211s1c1
Sequence:CCGGGCTGGTATTCTATGAAGGAAACTCGAGTTTCCTTCATAGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-404s1c1
Sequence:CCGGGCATTCGGTATTTACAGGAAACTCGAGTTTCCTGTAAATACCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-1172s21c1
Sequence:CCGGGTTTCGACGACGGCATTATTTCTCGAGAAATAATGCCGTCGTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-951s21c1
Sequence:CCGGTGCCTTCGACGGCTACGATTTCTCGAGAAATCGTAGCCGTCGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133862
FGG MISSION shRNA shRNA Plasmid DNA
fibrinogen gamma chain
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133862.1-1365s1c1
Sequence:CCGGCCAAGCAGAGAACTATACTATCTCGAGATAGTATAGTTCTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-128s1c1
Sequence:CCGGGATTCGGTAGTTTCTGCCCAACTCGAGTTGGGCAGAAACTACCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-912s1c1
Sequence:CCGGCCTGACCTATGCCTACTTCATCTCGAGATGAAGTAGGCATAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-1211s1c1
Sequence:CCGGGCTGGTATTCTATGAAGGAAACTCGAGTTTCCTTCATAGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-404s1c1
Sequence:CCGGGCATTCGGTATTTACAGGAAACTCGAGTTTCCTGTAAATACCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-1172s21c1
Sequence:CCGGGTTTCGACGACGGCATTATTTCTCGAGAAATAATGCCGTCGTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-951s21c1
Sequence:CCGGTGCCTTCGACGGCTACGATTTCTCGAGAAATCGTAGCCGTCGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133862
FGG MISSION shRNA Lentiviral Transduction Particles
fibrinogen gamma chain
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133862.1-1365s1c1
Sequence:CCGGCCAAGCAGAGAACTATACTATCTCGAGATAGTATAGTTCTCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-128s1c1
Sequence:CCGGGATTCGGTAGTTTCTGCCCAACTCGAGTTGGGCAGAAACTACCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-912s1c1
Sequence:CCGGCCTGACCTATGCCTACTTCATCTCGAGATGAAGTAGGCATAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-1211s1c1
Sequence:CCGGGCTGGTATTCTATGAAGGAAACTCGAGTTTCCTTCATAGAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133862.1-404s1c1
Sequence:CCGGGCATTCGGTATTTACAGGAAACTCGAGTTTCCTGTAAATACCGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-1172s21c1
Sequence:CCGGGTTTCGACGACGGCATTATTTCTCGAGAAATAATGCCGTCGTCGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133862.1-951s21c1
Sequence:CCGGTGCCTTCGACGGCTACGATTTCTCGAGAAATCGTAGCCGTCGAAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000509
VALIDATED
FGG MISSION shRNA Bacterial Glycerol Stock
fibrinogen gamma chain
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000509.3-1242s1c1
Sequence:CCGGCCGGTGGTATTCCATGAAGAACTCGAGTTCTTCATGGAATACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1393s1c1
Sequence:CCGGCTTTATCTGAACAGAGAGATACTCGAGTATCTCTCTGTTCAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1145s1c1
Sequence:CCGGGCCATCTCAATGGAGTTTATTCTCGAGAATAAACTCCATTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-143s1c1
Sequence:CCGGGCTGCATCTTAGATGAAAGATCTCGAGATCTTTCATCTAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-253s1c1
Sequence:CCGGGACATCTTACATCAAGTTGAACTCGAGTTCAACTTGATGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-686s21c1
Sequence:CCGGTTGCCAATAAGGGAGCTAAACCTCGAGGTTTAGCTCCCTTATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1289s21c1
Sequence:CCGGCATCTACTCCTAATGGTTATGCTCGAGCATAACCATTAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-405s21c1
Sequence:CCGGAGCAATCCAACTCACTTATAACTCGAGTTATAAGTGAGTTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000509.4-1484s21c1
Sequence:CCGGTTAAAGGACTTTATCTGAACACTCGAGTGTTCAGATAAAGTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1033s21c1
Sequence:CCGGGACAAGTACCGCCTAACATATCTCGAGATATGTTAGGCGGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-253s21c1
Sequence:CCGGGATGAAAGATTCGGTAGTTATCTCGAGATAACTACCGAATCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000509
VALIDATED
FGG MISSION shRNA shRNA Plasmid DNA
fibrinogen gamma chain
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000509.3-1242s1c1
Sequence:CCGGCCGGTGGTATTCCATGAAGAACTCGAGTTCTTCATGGAATACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1393s1c1
Sequence:CCGGCTTTATCTGAACAGAGAGATACTCGAGTATCTCTCTGTTCAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1145s1c1
Sequence:CCGGGCCATCTCAATGGAGTTTATTCTCGAGAATAAACTCCATTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-143s1c1
Sequence:CCGGGCTGCATCTTAGATGAAAGATCTCGAGATCTTTCATCTAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-253s1c1
Sequence:CCGGGACATCTTACATCAAGTTGAACTCGAGTTCAACTTGATGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-686s21c1
Sequence:CCGGTTGCCAATAAGGGAGCTAAACCTCGAGGTTTAGCTCCCTTATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1289s21c1
Sequence:CCGGCATCTACTCCTAATGGTTATGCTCGAGCATAACCATTAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-405s21c1
Sequence:CCGGAGCAATCCAACTCACTTATAACTCGAGTTATAAGTGAGTTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000509.4-1484s21c1
Sequence:CCGGTTAAAGGACTTTATCTGAACACTCGAGTGTTCAGATAAAGTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1033s21c1
Sequence:CCGGGACAAGTACCGCCTAACATATCTCGAGATATGTTAGGCGGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-253s21c1
Sequence:CCGGGATGAAAGATTCGGTAGTTATCTCGAGATAACTACCGAATCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000509
VALIDATED
FGG MISSION shRNA Lentiviral Transduction Particles
fibrinogen gamma chain
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000509.3-1242s1c1
Sequence:CCGGCCGGTGGTATTCCATGAAGAACTCGAGTTCTTCATGGAATACCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083763    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1393s1c1
Sequence:CCGGCTTTATCTGAACAGAGAGATACTCGAGTATCTCTCTGTTCAGATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-1145s1c1
Sequence:CCGGGCCATCTCAATGGAGTTTATTCTCGAGAATAAACTCCATTGAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-143s1c1
Sequence:CCGGGCTGCATCTTAGATGAAAGATCTCGAGATCTTTCATCTAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000509.3-253s1c1
Sequence:CCGGGACATCTTACATCAAGTTGAACTCGAGTTCAACTTGATGTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-686s21c1
Sequence:CCGGTTGCCAATAAGGGAGCTAAACCTCGAGGTTTAGCTCCCTTATTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1289s21c1
Sequence:CCGGCATCTACTCCTAATGGTTATGCTCGAGCATAACCATTAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-405s21c1
Sequence:CCGGAGCAATCCAACTCACTTATAACTCGAGTTATAAGTGAGTTGGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000509.4-1484s21c1
Sequence:CCGGTTAAAGGACTTTATCTGAACACTCGAGTGTTCAGATAAAGTCCTTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-1033s21c1
Sequence:CCGGGACAAGTACCGCCTAACATATCTCGAGATATGTTAGGCGGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000509.4-253s21c1
Sequence:CCGGGATGAAAGATTCGGTAGTTATCTCGAGATAACTACCGAATCTTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks