EMAIL THIS PAGE TO A FRIEND

FGGY

FGGY carbohydrate kinase domain containing

113 Gene Product Result for
Gene ID:
Human(55277) Summary: This gene encodes a protein that phosphorylates carbohydrates such as ribulose, ribitol, and L-arabinitol. Genome-wide association studies in some populations have found an association between polymorphisms in this gene and sporadic amyotrophic lateral sclerosis, but studies of other populations have not been able to replicate this association. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(75578) FGGY carbohydrate kinase domain containing
Rat(298250) FGGY carbohydrate kinase domain containing
naked mole-rat(101720549) FGGY carbohydrate kinase domain containing
domestic guinea pig(100727187) FGGY carbohydrate kinase domain containing
sheep(101104022) FGGY carbohydrate kinase domain containing
Domestic Rabbit(100358699) FGGY carbohydrate kinase domain containing
Zebrafish(406567) FGGY carbohydrate kinase domain containing
chicken(772383) FGGY carbohydrate kinase domain containing
dog(479554) FGGY carbohydrate kinase domain containing
cow(534011) FGGY carbohydrate kinase domain containing
Horse(100067351) FGGY carbohydrate kinase domain containing
domestic cat(101100577) FGGY carbohydrate kinase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_131496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113411 Rosetta Predictions human pricing
NM_018291 Rosetta Predictions human pricing
NM_001013932 Rosetta Predictions rat pricing
NM_001113412 Rosetta Predictions mouse pricing
NM_029347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325841 predicted 403
2 SASI_Hs02_00325842 predicted 773
3 SASI_Hs02_00325843 predicted 677
4 SASI_Hs02_00325844 predicted 689
5 SASI_Hs02_00325845 predicted 407
6 SASI_Hs02_00325846 predicted 576
7 SASI_Hs02_00325847 predicted 1814
8 SASI_Hs02_00325848 predicted 847
9 SASI_Hs02_00325849 predicted 1810
10 SASI_Hs02_00325850 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351677 predicted 411
2 SASI_Hs01_00109424 predicted 779
3 SASI_Hs02_00351678 predicted 680
4 SASI_Hs01_00109427 predicted 691
5 SASI_Hs02_00351679 predicted 416
6 SASI_Hs02_00351680 predicted 579
7 SASI_Hs01_00109429 predicted 1736
8 SASI_Hs01_00109430 predicted 851
9 SASI_Hs02_00351681 predicted 1734
10 SASI_Hs02_00351682 predicted 647
11 SASI_Hs01_00109422 predicted 1379
12 SASI_Hs01_00109423 predicted 1347
13 SASI_Hs01_00109425 predicted 1294
14 SASI_Hs01_00109426 predicted 1438
15 SASI_Hs01_00109428 predicted 971
16 SASI_Hs01_00109431 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201232 predicted 290
2 SASI_Rn02_00201233 predicted 365
3 SASI_Rn01_00121935 predicted 885
4 SASI_Rn01_00121937 predicted 1365
5 SASI_Rn01_00121938 predicted 1480
6 SASI_Rn01_00121941 predicted 951
7 SASI_Rn02_00201234 predicted 703
8 SASI_Rn02_00201235 predicted 297
9 SASI_Rn02_00201236 predicted 456
10 SASI_Rn02_00201237 predicted 1165
11 SASI_Rn01_00121932 predicted 385
12 SASI_Rn01_00121933 predicted 854
13 SASI_Rn01_00121934 predicted 1255
14 SASI_Rn01_00121936 predicted 822
15 SASI_Rn01_00121939 predicted 771
16 SASI_Rn01_00121940 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307786 predicted 698
2 SASI_Mm02_00307787 predicted 377
3 SASI_Mm02_00307788 predicted 311
4 SASI_Mm02_00307789 predicted 704
5 SASI_Mm02_00307790 predicted 689
6 SASI_Mm02_00307791 predicted 863
7 SASI_Mm02_00307792 predicted 920
8 SASI_Mm02_00307793 predicted 470
9 SASI_Mm02_00307794 predicted 533
10 SASI_Mm02_00307795 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054577 predicted 746
2 SASI_Mm01_00054579 predicted 424
3 SASI_Mm02_00335183 predicted 353
4 SASI_Mm02_00335184 predicted 750
5 SASI_Mm01_00054583 predicted 737
6 SASI_Mm02_00335185 predicted 916
7 SASI_Mm02_00335186 predicted 978
8 SASI_Mm02_00335187 predicted 516
9 SASI_Mm02_00335188 predicted 585
10 SASI_Mm02_00335189 predicted 534
11 SASI_Mm01_00054576 predicted 1227
12 SASI_Mm01_00054578 predicted 1147
13 SASI_Mm01_00054580 predicted 1293
14 SASI_Mm01_00054581 predicted 978
15 SASI_Mm01_00054582 predicted 979
16 SASI_Mm01_00054584 predicted 1196
17 SASI_Mm01_00054585 predicted 943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029347
FGGY MISSION shRNA Bacterial Glycerol Stock
FGGY carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-255s21c1
Sequence:CCGGTTCGCAGAGCAGCCAATTAAGCTCGAGCTTAATTGGCTGCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1423s21c1
Sequence:CCGGAGAGCTTTGGAAGGTTCATTTCTCGAGAAATGAACCTTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1486s21c1
Sequence:CCGGCTTAACCCAGTGAAGTATTATCTCGAGATAATACTTCACTGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-510s21c1
Sequence:CCGGAGCCAGGTCCACAGGATTAATCTCGAGATTAATCCTGTGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029347
FGGY MISSION shRNA shRNA Plasmid DNA
FGGY carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-255s21c1
Sequence:CCGGTTCGCAGAGCAGCCAATTAAGCTCGAGCTTAATTGGCTGCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1423s21c1
Sequence:CCGGAGAGCTTTGGAAGGTTCATTTCTCGAGAAATGAACCTTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1486s21c1
Sequence:CCGGCTTAACCCAGTGAAGTATTATCTCGAGATAATACTTCACTGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-510s21c1
Sequence:CCGGAGCCAGGTCCACAGGATTAATCTCGAGATTAATCCTGTGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029347
FGGY MISSION shRNA Lentiviral Transduction Particles
FGGY carbohydrate kinase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-255s21c1
Sequence:CCGGTTCGCAGAGCAGCCAATTAAGCTCGAGCTTAATTGGCTGCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1423s21c1
Sequence:CCGGAGAGCTTTGGAAGGTTCATTTCTCGAGAAATGAACCTTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029347.2-1486s21c1
Sequence:CCGGCTTAACCCAGTGAAGTATTATCTCGAGATAATACTTCACTGGGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029347.2-510s21c1
Sequence:CCGGAGCCAGGTCCACAGGATTAATCTCGAGATTAATCCTGTGGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018291
VALIDATED
FGGY MISSION shRNA Bacterial Glycerol Stock
FGGY carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-416s21c1
Sequence:GTACCGGAGTTGTACAAGGGATTGATTTCTCGAGAAATCAATCCCTTGTACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-696s21c1
Sequence:CCGGTGGGATAAGGCGGGACATTTCCTCGAGGAAATGTCCCGCCTTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-563s21c1
Sequence:CCGGTCGAGCAGTCAGTCAAGTTAACTCGAGTTAACTTGACTGACTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1826s21c1
Sequence:CCGGTGAACACCAGAAGGAGTATTTCTCGAGAAATACTCCTTCTGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1114s21c1
Sequence:CCGGGGATCAGCAAAGACCCGATTTCTCGAGAAATCGGGTCTTTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1374s1c1
Sequence:CCGGCCACAGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1173s1c1
Sequence:CCGGGCCAGAGTATATATGCATATTCTCGAGAATATGCATATATACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-734s1c1
Sequence:CCGGGAAGACTTTGTTGCAGATAATCTCGAGATTATCTGCAACAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-863s1c1
Sequence:CCGGGCTTCACTCATTGATGCCCATCTCGAGATGGGCATCAATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1232s1c1
Sequence:CCGGGTGGGTTTCCTTACTGTTGATCTCGAGATCAACAGTAAGGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018291
VALIDATED
FGGY MISSION shRNA shRNA Plasmid DNA
FGGY carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-416s21c1
Sequence:GTACCGGAGTTGTACAAGGGATTGATTTCTCGAGAAATCAATCCCTTGTACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-696s21c1
Sequence:CCGGTGGGATAAGGCGGGACATTTCCTCGAGGAAATGTCCCGCCTTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-563s21c1
Sequence:CCGGTCGAGCAGTCAGTCAAGTTAACTCGAGTTAACTTGACTGACTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1826s21c1
Sequence:CCGGTGAACACCAGAAGGAGTATTTCTCGAGAAATACTCCTTCTGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1114s21c1
Sequence:CCGGGGATCAGCAAAGACCCGATTTCTCGAGAAATCGGGTCTTTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1374s1c1
Sequence:CCGGCCACAGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1173s1c1
Sequence:CCGGGCCAGAGTATATATGCATATTCTCGAGAATATGCATATATACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-734s1c1
Sequence:CCGGGAAGACTTTGTTGCAGATAATCTCGAGATTATCTGCAACAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-863s1c1
Sequence:CCGGGCTTCACTCATTGATGCCCATCTCGAGATGGGCATCAATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1232s1c1
Sequence:CCGGGTGGGTTTCCTTACTGTTGATCTCGAGATCAACAGTAAGGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018291
VALIDATED
FGGY MISSION shRNA Lentiviral Transduction Particles
FGGY carbohydrate kinase domain containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-416s21c1
Sequence:GTACCGGAGTTGTACAAGGGATTGATTTCTCGAGAAATCAATCCCTTGTACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-696s21c1
Sequence:CCGGTGGGATAAGGCGGGACATTTCCTCGAGGAAATGTCCCGCCTTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-563s21c1
Sequence:CCGGTCGAGCAGTCAGTCAAGTTAACTCGAGTTAACTTGACTGACTGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1826s21c1
Sequence:CCGGTGAACACCAGAAGGAGTATTTCTCGAGAAATACTCCTTCTGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018291.3-1114s21c1
Sequence:CCGGGGATCAGCAAAGACCCGATTTCTCGAGAAATCGGGTCTTTGCTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1374s1c1
Sequence:CCGGCCACAGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1173s1c1
Sequence:CCGGGCCAGAGTATATATGCATATTCTCGAGAATATGCATATATACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-734s1c1
Sequence:CCGGGAAGACTTTGTTGCAGATAATCTCGAGATTATCTGCAACAAAGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_018291.2-863s1c1
Sequence:CCGGGCTTCACTCATTGATGCCCATCTCGAGATGGGCATCAATGAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018291.2-1232s1c1
Sequence:CCGGGTGGGTTTCCTTACTGTTGATCTCGAGATCAACAGTAAGGAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131496
FGGY MISSION shRNA Bacterial Glycerol Stock
FGGY carbohydrate kinase domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1424s1c1
Sequence:CCGGCCACTGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-439s1c1
Sequence:CCGGCCTTTACCAGTAAACCATGAACTCGAGTTCATGGTTTACTGGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-660s1c1
Sequence:CCGGCCCAGACTTCTTATCATGGAACTCGAGTTCCATGATAAGAAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1183s1c1
Sequence:CCGGCCTGCCTTTCCTGAACTACAACTCGAGTTGTAGTTCAGGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1767s1c1
Sequence:CCGGCCAGAAGGAGTATTCAGCAATCTCGAGATTGCTGAATACTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131496
FGGY MISSION shRNA shRNA Plasmid DNA
FGGY carbohydrate kinase domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1424s1c1
Sequence:CCGGCCACTGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-439s1c1
Sequence:CCGGCCTTTACCAGTAAACCATGAACTCGAGTTCATGGTTTACTGGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-660s1c1
Sequence:CCGGCCCAGACTTCTTATCATGGAACTCGAGTTCCATGATAAGAAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1183s1c1
Sequence:CCGGCCTGCCTTTCCTGAACTACAACTCGAGTTGTAGTTCAGGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1767s1c1
Sequence:CCGGCCAGAAGGAGTATTCAGCAATCTCGAGATTGCTGAATACTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131496
FGGY MISSION shRNA Lentiviral Transduction Particles
FGGY carbohydrate kinase domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1424s1c1
Sequence:CCGGCCACTGTTCAAGCCATTGCTTCTCGAGAAGCAATGGCTTGAACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-439s1c1
Sequence:CCGGCCTTTACCAGTAAACCATGAACTCGAGTTCATGGTTTACTGGTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-660s1c1
Sequence:CCGGCCCAGACTTCTTATCATGGAACTCGAGTTCCATGATAAGAAGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1183s1c1
Sequence:CCGGCCTGCCTTTCCTGAACTACAACTCGAGTTGTAGTTCAGGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131496.4-1767s1c1
Sequence:CCGGCCAGAAGGAGTATTCAGCAATCTCGAGATTGCTGAATACTCCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks