EMAIL THIS PAGE TO A FRIEND

FGL1

fibrinogen-like 1

119 Gene Product Result for
Synonyms: HFREP1 HP-041 LFIRE-1 LFIRE1
UniProtKB ID: Q08830, A6NKU4, Q4PJH9, Q53YF1, Q96KW6, Q96QM6
Gene ID:
Human(2267) Summary: Fibrinogen-like 1 is a member of the fibrinogen family. This protein is homologous to the carboxy terminus of the fibrinogen beta- and gamma- subunits which contains the four conserved cysteines of fibrinogens and fibrinogen related proteins. However, this protein lacks the platelet-binding site, cross-linking region and a thrombin-sensitive site which are necessary for fibrin clot formation. This protein may play a role in the development of hepatocellular carcinomas. Four alternatively spliced transcript variants encoding the same protein exist for this gene. [provided by RefSeq, Jul 2008]
Mouse(234199) fibrinogen-like protein 1
Rat(246186) fibrinogen-like 1
chicken(422728) fibrinogen-like 1
cow(508090) fibrinogen-like 1
domestic cat(101082746) fibrinogen-like 1
dog(475617) fibrinogen-like 1
sheep(101118665) fibrinogen-like 1
domestic guinea pig(100734248) fibrinogen-like 1
naked mole-rat(101697882) fibrinogen-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004467 Rosetta Predictions human pricing
NM_147203 Rosetta Predictions human pricing
NM_201552 Rosetta Predictions human pricing
NM_201553 Rosetta Predictions human pricing
NM_172010 Rosetta Predictions rat pricing
NM_145594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018735 predicted 601
2 SASI_Hs02_00337672 predicted 780
3 SASI_Hs01_00018739 predicted 952
4 SASI_Hs02_00337673 predicted 978
5 SASI_Hs02_00337674 predicted 785
6 SASI_Hs01_00018740 predicted 457
7 SASI_Hs01_00018741 predicted 600
8 SASI_Hs01_00018742 predicted 815
9 SASI_Hs01_00018743 predicted 604
10 SASI_Hs01_00018744 predicted 563
11 SASI_Hs01_00018736 predicted 477
12 SASI_Hs01_00018737 predicted 372
13 SASI_Hs01_00018738 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204228 predicted 692
2 SASI_Hs02_00365545 predicted 873
3 SASI_Hs01_00204232 predicted 1039
4 SASI_Hs02_00365546 predicted 1064
5 SASI_Hs02_00365547 predicted 867
6 SASI_Hs01_00204233 predicted 549
7 SASI_Hs01_00204234 predicted 686
8 SASI_Hs01_00204235 predicted 911
9 SASI_Hs01_00204236 predicted 685
10 SASI_Hs01_00204237 predicted 652
11 SASI_Hs01_00204229 predicted 566
12 SASI_Hs01_00204230 predicted 467
13 SASI_Hs01_00204231 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244394 predicted 728
2 SASI_Hs02_00373038 predicted 910
3 SASI_Hs01_00244398 predicted 1077
4 SASI_Hs02_00373039 predicted 1101
5 SASI_Hs02_00373040 predicted 915
6 SASI_Hs01_00244399 predicted 585
7 SASI_Hs01_00244400 predicted 722
8 SASI_Hs01_00244401 predicted 948
9 SASI_Hs01_00244402 predicted 729
10 SASI_Hs01_00244403 predicted 687
11 SASI_Hs01_00244395 predicted 612
12 SASI_Hs01_00244396 predicted 503
13 SASI_Hs01_00244397 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206174 predicted 817
2 SASI_Hs02_00373041 predicted 997
3 SASI_Hs01_00206178 predicted 1164
4 SASI_Hs02_00373042 predicted 1194
5 SASI_Hs02_00373043 predicted 1002
6 SASI_Hs01_00206179 predicted 669
7 SASI_Hs01_00206180 predicted 818
8 SASI_Hs01_00206181 predicted 1031
9 SASI_Hs01_00206182 predicted 815
10 SASI_Hs01_00206183 predicted 774
11 SASI_Hs01_00206175 predicted 700
12 SASI_Hs01_00206176 predicted 593
13 SASI_Hs01_00206177 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046120 predicted 344
2 SASI_Rn01_00046121 predicted 216
3 SASI_Rn01_00046122 predicted 404
4 SASI_Rn01_00046123 predicted 333
5 SASI_Rn01_00046124 predicted 213
6 SASI_Rn01_00046125 predicted 370
7 SASI_Rn01_00046126 predicted 534
8 SASI_Rn01_00046127 predicted 369
9 SASI_Rn01_00046128 predicted 625
10 SASI_Rn01_00046129 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341130 predicted 294
2 SASI_Mm01_00079879 predicted 260
3 SASI_Mm02_00341131 predicted 296
4 SASI_Mm01_00079880 predicted 841
5 SASI_Mm01_00079881 predicted 327
6 SASI_Mm01_00079882 predicted 301
7 SASI_Mm01_00079883 predicted 293
8 SASI_Mm01_00079884 predicted 698
9 SASI_Mm01_00079885 predicted 843
10 SASI_Mm01_00079887 predicted 313
11 SASI_Mm01_00079886 predicted 742
12 SASI_Mm01_00079888 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004467
VALIDATED
FGL1 MISSION shRNA Bacterial Glycerol Stock
fibrinogen-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-1115s1c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-284s1c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-295s1c1
Sequence:CCGGCCTTGATAAAGGAGATGAGAACTCGAGTTCTCATCTCCTTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-657s1c1
Sequence:CCGGGCCGTTATGCACAATATAAGACTCGAGTCTTATATTGTGCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-821s1c1
Sequence:CCGGGACAGAGATCATGACAACTATCTCGAGATAGTTGTCATGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004467.3-788s1c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-278s1c1
Sequence:CCGGGAGAATGAAGTCCAGTTCCTTCTCGAGAAGGAACTGGACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-483s1c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-784s1c1
Sequence:CCGGGTGGGCTAGTCACCAAAGAATCTCGAGATTCTTTGGTGACTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-284s21c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-788s21c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004467.3-1115s21c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-483s21c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004467
VALIDATED
FGL1 MISSION shRNA shRNA Plasmid DNA
fibrinogen-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-1115s1c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-284s1c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-295s1c1
Sequence:CCGGCCTTGATAAAGGAGATGAGAACTCGAGTTCTCATCTCCTTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-657s1c1
Sequence:CCGGGCCGTTATGCACAATATAAGACTCGAGTCTTATATTGTGCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-821s1c1
Sequence:CCGGGACAGAGATCATGACAACTATCTCGAGATAGTTGTCATGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004467.3-788s1c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-278s1c1
Sequence:CCGGGAGAATGAAGTCCAGTTCCTTCTCGAGAAGGAACTGGACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-483s1c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-784s1c1
Sequence:CCGGGTGGGCTAGTCACCAAAGAATCTCGAGATTCTTTGGTGACTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-284s21c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-788s21c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004467.3-1115s21c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-483s21c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004467
VALIDATED
FGL1 MISSION shRNA Lentiviral Transduction Particles
fibrinogen-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153532    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-1115s1c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-284s1c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-295s1c1
Sequence:CCGGCCTTGATAAAGGAGATGAGAACTCGAGTTCTCATCTCCTTTATCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-657s1c1
Sequence:CCGGGCCGTTATGCACAATATAAGACTCGAGTCTTATATTGTGCATAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-821s1c1
Sequence:CCGGGACAGAGATCATGACAACTATCTCGAGATAGTTGTCATGATCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004467.3-788s1c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-278s1c1
Sequence:CCGGGAGAATGAAGTCCAGTTCCTTCTCGAGAAGGAACTGGACTTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004467.3-483s1c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004467.3-784s1c1
Sequence:CCGGGTGGGCTAGTCACCAAAGAATCTCGAGATTCTTTGGTGACTAGCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-284s21c1
Sequence:CCGGGAAGTCCAGTTCCTTGATAAACTCGAGTTTATCAAGGAACTGGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-788s21c1
Sequence:CCGGGCTAGTCACCAAAGAATGAAACTCGAGTTTCATTCTTTGGTGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004467.3-1115s21c1
Sequence:CCGGCTGAACATATCCATGCGCAATCTCGAGATTGCGCATGGATATGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004467.3-483s21c1
Sequence:CCGGGACGATCTGATGGCAGTGAAACTCGAGTTTCACTGCCATCAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145594
VALIDATED
FGL1 MISSION shRNA Bacterial Glycerol Stock
fibrinogen-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-551s1c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-299s1c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-490s1c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-88s1c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-329s1c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-551s21c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-88s21c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-329s21c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-299s21c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-490s21c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145594
VALIDATED
FGL1 MISSION shRNA shRNA Plasmid DNA
fibrinogen-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-551s1c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-299s1c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-490s1c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-88s1c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-329s1c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-551s21c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-88s21c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-329s21c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-299s21c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-490s21c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145594
VALIDATED
FGL1 MISSION shRNA Lentiviral Transduction Particles
fibrinogen-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-551s1c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-299s1c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-490s1c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145594.1-88s1c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145594.1-329s1c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-551s21c1
Sequence:CCGGGCTAACTATTCAAGGAGACTACTCGAGTAGTCTCCTTGAATAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-88s21c1
Sequence:CCGGCCATTGCTCTGATGATGGGAACTCGAGTTCCCATCATCAGAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-329s21c1
Sequence:CCGGCGGATTTAAGCAGAGTGGATTCTCGAGAATCCACTCTGCTTAAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-299s21c1
Sequence:CCGGGTATGCAGATTGTTCAGAGATCTCGAGATCTCTGAACAATCTGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145594.1-490s21c1
Sequence:CCGGGCTTTGGAAACTTTGTCCAAACTCGAGTTTGGACAAAGTTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks