EMAIL THIS PAGE TO A FRIEND

FGL2

fibrinogen-like 2

136 Gene Product Result for
Synonyms: T49 pT49
UniProtKB ID: Q14314
Gene ID:
Human(10875) Summary: The protein encoded by this gene is a secreted protein that is similar to the beta- and gamma-chains of fibrinogen. The carboxyl-terminus of the encoded protein consists of the fibrinogen-related domains (FRED). The encoded protein forms a tetrameric complex which is stabilized by interchain disulfide bonds. This protein may play a role in physiologic functions at mucosal sites. [provided by RefSeq, Jul 2008]
Mouse(14190) fibrinogen-like protein 2
Rat(84586) fibrinogen-like 2
sheep(101118266) fibrinogen-like 2
Domestic Rabbit(100351573) fibrinogen-like 2
Zebrafish(565637) fibrinogen-like 2
cow(511711) fibrinogen-like 2
Horse(100050110) fibrinogen-like 2
domestic cat(101088395) fibrinogen-like 2
dog(475902) fibrinogen-like 2
chicken(768821) fibrinogen-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006682 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130941 MISSION® esiRNA esiRNA human FGL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006682 Rosetta Predictions human pricing
NM_053455 Rosetta Predictions rat pricing
NM_008013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071263 predicted 290
2 SASI_Hs01_00071264 predicted 1017
3 SASI_Hs01_00071265 predicted 428
4 SASI_Hs01_00071266 predicted 952
5 SASI_Hs01_00071267 predicted 934
6 SASI_Hs01_00071268 predicted 1008
7 SASI_Hs01_00071270 predicted 654
8 SASI_Hs01_00071271 predicted 995
9 SASI_Hs01_00071272 predicted 576
10 SASI_Hs02_00342086 predicted 1126
11 SASI_Hs01_00071269 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084620 predicted 893
2 SASI_Rn01_00084621 predicted 1153
3 SASI_Rn01_00084622 predicted 955
4 SASI_Rn01_00084623 predicted 1247
5 SASI_Rn01_00084624 predicted 307
6 SASI_Rn01_00084625 predicted 609
7 SASI_Rn01_00084627 predicted 596
8 SASI_Rn02_00266031 predicted 962
9 SASI_Rn01_00084628 predicted 924
10 SASI_Rn01_00084629 predicted 497
11 SASI_Rn01_00084626 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081410 predicted 1149
2 SASI_Mm01_00081411 predicted 956
3 SASI_Mm02_00312951 predicted 1162
4 SASI_Mm01_00081413 predicted 893
5 SASI_Mm01_00081414 predicted 1339
6 SASI_Mm01_00081415 predicted 1163
7 SASI_Mm01_00081416 predicted 1286
8 SASI_Mm01_00081417 predicted 1296
9 SASI_Mm01_00081418 predicted 909
10 SASI_Mm01_00081419 predicted 1407
11 SASI_Mm01_00081412 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008013
FGL2 MISSION shRNA Bacterial Glycerol Stock
fibrinogen-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008013.4-925s21c1
Sequence:CCGGGAATAGATCTTGAAGACTTTACTCGAGTAAAGTCTTCAAGATCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008013.4-1763s21c1
Sequence:CCGGTTCGTCTAAGAAGAACTTAAACTCGAGTTTAAGTTCTTCTTAGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008013.2-3252s1c1
Sequence:CCGGGCCTTAACAATTCACTGATATCTCGAGATATCAGTGAATTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-477s1c1
Sequence:CCGGCCATCTGGTAAATATGAACAACTCGAGTTGTTCATATTTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1153s1c1
Sequence:CCGGGCCAACTTAAATGGCAAATATCTCGAGATATTTGCCATTTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-603s1c1
Sequence:CCGGGCCGGTTCAACATCTAATATACTCGAGTATATTAGATGTTGAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1293s1c1
Sequence:CCGGGCCCAAGAATTTCAAGCCATACTCGAGTATGGCTTGAAATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008013
FGL2 MISSION shRNA shRNA Plasmid DNA
fibrinogen-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008013.4-925s21c1
Sequence:CCGGGAATAGATCTTGAAGACTTTACTCGAGTAAAGTCTTCAAGATCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008013.4-1763s21c1
Sequence:CCGGTTCGTCTAAGAAGAACTTAAACTCGAGTTTAAGTTCTTCTTAGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008013.2-3252s1c1
Sequence:CCGGGCCTTAACAATTCACTGATATCTCGAGATATCAGTGAATTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-477s1c1
Sequence:CCGGCCATCTGGTAAATATGAACAACTCGAGTTGTTCATATTTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1153s1c1
Sequence:CCGGGCCAACTTAAATGGCAAATATCTCGAGATATTTGCCATTTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-603s1c1
Sequence:CCGGGCCGGTTCAACATCTAATATACTCGAGTATATTAGATGTTGAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1293s1c1
Sequence:CCGGGCCCAAGAATTTCAAGCCATACTCGAGTATGGCTTGAAATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008013
FGL2 MISSION shRNA Lentiviral Transduction Particles
fibrinogen-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008013.4-925s21c1
Sequence:CCGGGAATAGATCTTGAAGACTTTACTCGAGTAAAGTCTTCAAGATCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008013.4-1763s21c1
Sequence:CCGGTTCGTCTAAGAAGAACTTAAACTCGAGTTTAAGTTCTTCTTAGACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008013.2-3252s1c1
Sequence:CCGGGCCTTAACAATTCACTGATATCTCGAGATATCAGTGAATTGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-477s1c1
Sequence:CCGGCCATCTGGTAAATATGAACAACTCGAGTTGTTCATATTTACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1153s1c1
Sequence:CCGGGCCAACTTAAATGGCAAATATCTCGAGATATTTGCCATTTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-603s1c1
Sequence:CCGGGCCGGTTCAACATCTAATATACTCGAGTATATTAGATGTTGAACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008013.2-1293s1c1
Sequence:CCGGGCCCAAGAATTTCAAGCCATACTCGAGTATGGCTTGAAATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006682
FGL2 MISSION shRNA Bacterial Glycerol Stock
fibrinogen-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006682.2-1389s21c1
Sequence:CCGGGTTATCTAATAGGGCAATTAACTCGAGTTAATTGCCCTATTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-646s21c1
Sequence:CCGGACGTCCAGTTCAACATCTAATCTCGAGATTAGATGTTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-291s21c1
Sequence:CCGGACCTCAAGGAAATCGTAAATACTCGAGTATTTACGATTTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1057s1c1
Sequence:CCGGGCATTACGTTTCAACAAACATCTCGAGATGTTTGTTGAAACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-837s1c1
Sequence:CCGGGCAAGACTACAAAGCAGGCTTCTCGAGAAGCCTGCTTTGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-456s1c1
Sequence:CCGGCTCTGAGCTAAAGAATGCCAACTCGAGTTGGCATTCTTTAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1019s1c1
Sequence:CCGGGTTTACACGTTGGTAACTATACTCGAGTATAGTTACCAACGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-583s1c1
Sequence:CCGGGTCAATAGTTTGGATGGCAAACTCGAGTTTGCCATCCAAACTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006682
FGL2 MISSION shRNA shRNA Plasmid DNA
fibrinogen-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006682.2-1389s21c1
Sequence:CCGGGTTATCTAATAGGGCAATTAACTCGAGTTAATTGCCCTATTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-646s21c1
Sequence:CCGGACGTCCAGTTCAACATCTAATCTCGAGATTAGATGTTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-291s21c1
Sequence:CCGGACCTCAAGGAAATCGTAAATACTCGAGTATTTACGATTTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1057s1c1
Sequence:CCGGGCATTACGTTTCAACAAACATCTCGAGATGTTTGTTGAAACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-837s1c1
Sequence:CCGGGCAAGACTACAAAGCAGGCTTCTCGAGAAGCCTGCTTTGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-456s1c1
Sequence:CCGGCTCTGAGCTAAAGAATGCCAACTCGAGTTGGCATTCTTTAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1019s1c1
Sequence:CCGGGTTTACACGTTGGTAACTATACTCGAGTATAGTTACCAACGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-583s1c1
Sequence:CCGGGTCAATAGTTTGGATGGCAAACTCGAGTTTGCCATCCAAACTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006682
FGL2 MISSION shRNA Lentiviral Transduction Particles
fibrinogen-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006682.2-1389s21c1
Sequence:CCGGGTTATCTAATAGGGCAATTAACTCGAGTTAATTGCCCTATTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-646s21c1
Sequence:CCGGACGTCCAGTTCAACATCTAATCTCGAGATTAGATGTTGAACTGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006682.2-291s21c1
Sequence:CCGGACCTCAAGGAAATCGTAAATACTCGAGTATTTACGATTTCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1057s1c1
Sequence:CCGGGCATTACGTTTCAACAAACATCTCGAGATGTTTGTTGAAACGTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-837s1c1
Sequence:CCGGGCAAGACTACAAAGCAGGCTTCTCGAGAAGCCTGCTTTGTAGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-456s1c1
Sequence:CCGGCTCTGAGCTAAAGAATGCCAACTCGAGTTGGCATTCTTTAGCTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-1019s1c1
Sequence:CCGGGTTTACACGTTGGTAACTATACTCGAGTATAGTTACCAACGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006682.1-583s1c1
Sequence:CCGGGTCAATAGTTTGGATGGCAAACTCGAGTTTGCCATCCAAACTATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks