EMAIL THIS PAGE TO A FRIEND

FGR

feline Gardner-Rasheed sarcoma viral oncogene homolog

98 Gene Product Result for
Synonyms: SRC2 c-fgr c-src2 p55-Fgr p55c-fgr p58-Fgr p58c-fgr
UniProtKB ID: P09769, D3DPL7, Q9UIQ3
Gene ID:
Human(2268) Summary: This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Mouse(14191) Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog
Rat(79113) feline Gardner-Rasheed sarcoma viral oncogene
dog(487341) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
domestic cat(101083781) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
cow(516133) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
Horse(100056804) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
sheep(101107075) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
domestic guinea pig(100735748) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
naked mole-rat(101704214) Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F6680 Anti-FGR (28-40) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F6805 Anti-FGR (487-500) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500396 Anti-FGR antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1405811 Anti-FGR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412032 ANTI-FGR antibody produced in mouse clone 3B11, purified immunoglobulin, buffered aqueous solution , human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412033 ANTI-FGR antibody produced in mouse clone 4C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412034 ANTI-FGR antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA002024 Anti-FGR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500891 Anti-FGR antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4500890 Anti-FGR, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
WH0002268M1 Monoclonal Anti-FGR antibody produced in mouse clone 3G10, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB5300464 Monoclonal Anti-FGR antibody produced in mouse clone 6G2, ascites fluid human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1403818 Monoclonal Anti-FGR, (N-terminal) antibody produced in mouse clone 1B12, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0963 Phosphotyrosine FGR / Tyrosine-protein Kinase Fgr ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing
AQ0427 AQUA Peptide LIEDNEYTA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042729 Rosetta Predictions human pricing
NM_001042747 Rosetta Predictions human pricing
NM_005248 Rosetta Predictions human pricing
NM_024145 Rosetta Predictions rat pricing
NM_010208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311109 predicted 820
2 SASI_Hs02_00311110 predicted 518
3 SASI_Hs02_00311111 predicted 1395
4 SASI_Hs02_00311112 predicted 1508
5 SASI_Hs02_00311113 predicted 1208
6 SASI_Hs02_00311114 predicted 443
7 SASI_Hs02_00311115 predicted 701
8 SASI_Hs02_00311116 predicted 1667
9 SASI_Hs02_00311117 predicted 1050
10 SASI_Hs02_00311118 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311129 predicted 872
2 SASI_Hs02_00311130 predicted 576
3 SASI_Hs02_00311131 predicted 1450
4 SASI_Hs02_00311132 predicted 1567
5 SASI_Hs02_00311133 predicted 1265
6 SASI_Hs02_00311134 predicted 504
7 SASI_Hs02_00311135 predicted 769
8 SASI_Hs02_00311136 predicted 1719
9 SASI_Hs02_00311137 predicted 1111
10 SASI_Hs02_00311138 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142206 predicted 833
2 SASI_Hs02_00339265 predicted 542
3 SASI_Hs01_00142207 predicted 1408
4 SASI_Hs01_00142208 predicted 1522
5 SASI_Hs01_00142209 predicted 1226
6 SASI_Hs01_00142210 predicted 464
7 SASI_Hs01_00142211 predicted 721
8 SASI_Hs01_00142212 predicted 1677
9 SASI_Hs01_00142213 predicted 1060
10 SASI_Hs02_00339266 predicted 2216
11 SASI_Hs01_00142205 predicted 1437
12 SASI_Hs01_00142214 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065520 predicted 1763
2 SASI_Rn01_00065521 predicted 1156
3 SASI_Rn01_00065522 predicted 1740
4 SASI_Rn01_00065523 predicted 468
5 SASI_Rn01_00065524 predicted 1293
6 SASI_Rn01_00065525 predicted 1848
7 SASI_Rn01_00065526 predicted 1344
8 SASI_Rn01_00065527 predicted 476
9 SASI_Rn01_00065528 predicted 422
10 SASI_Rn01_00065529 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179205 predicted 792
2 SASI_Mm01_00179206 predicted 1574
3 SASI_Mm01_00179207 predicted 605
4 SASI_Mm01_00179208 predicted 1723
5 SASI_Mm01_00179209 predicted 1353
6 SASI_Mm01_00179210 predicted 1124
7 SASI_Mm01_00179211 predicted 770
8 SASI_Mm01_00179212 predicted 1348
9 SASI_Mm01_00179213 predicted 1327
10 SASI_Mm01_00179214 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005248
FGR MISSION shRNA Bacterial Glycerol Stock
feline Gardner-Rasheed sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.x-2247s1c1
Sequence:CCGGCCAGGTTTGAGGGAGAAGTTTCTCGAGAAACTTCTCCCTCAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-1529s1c1
Sequence:CCGGGCATGAATAAACGGGAAGTGTCTCGAGACACTTCCCGTTTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-460s1c1
Sequence:CCGGCACATCCTGAACAATACTGAACTCGAGTTCAGTATTGTTCAGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-385s1c1
Sequence:CCGGACCCTGTTCATTGCCCTGTATCTCGAGATACAGGGCAATGAACAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-339s1c1
Sequence:CCGGCTTCCTTGATAGTGGCACCATCTCGAGATGGTGCCACTATCAAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-386s1c1
Sequence:CCGGCCCTGTTCATTGCCCTGTATGCTCGAGCATACAGGGCAATGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1267s1c1
Sequence:CCGGGAACGCATGAACTACATTCACCTCGAGGTGAATGTAGTTCATGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.1-2145s1c1
Sequence:CCGGCCCTCTATTCTCTTGTGTCTGCTCGAGCAGACACAAGAGAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1330s1c1
Sequence:CCGGGCGTGCAAGATCGCAGACTTTCTCGAGAAAGTCTGCGATCTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-646s1c1
Sequence:CCGGGCCTTTCTCATTCGGGAAAGCCTCGAGGCTTTCCCGAATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005248
FGR MISSION shRNA shRNA Plasmid DNA
feline Gardner-Rasheed sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.x-2247s1c1
Sequence:CCGGCCAGGTTTGAGGGAGAAGTTTCTCGAGAAACTTCTCCCTCAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-1529s1c1
Sequence:CCGGGCATGAATAAACGGGAAGTGTCTCGAGACACTTCCCGTTTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-460s1c1
Sequence:CCGGCACATCCTGAACAATACTGAACTCGAGTTCAGTATTGTTCAGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-385s1c1
Sequence:CCGGACCCTGTTCATTGCCCTGTATCTCGAGATACAGGGCAATGAACAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-339s1c1
Sequence:CCGGCTTCCTTGATAGTGGCACCATCTCGAGATGGTGCCACTATCAAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-386s1c1
Sequence:CCGGCCCTGTTCATTGCCCTGTATGCTCGAGCATACAGGGCAATGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1267s1c1
Sequence:CCGGGAACGCATGAACTACATTCACCTCGAGGTGAATGTAGTTCATGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.1-2145s1c1
Sequence:CCGGCCCTCTATTCTCTTGTGTCTGCTCGAGCAGACACAAGAGAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1330s1c1
Sequence:CCGGGCGTGCAAGATCGCAGACTTTCTCGAGAAAGTCTGCGATCTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-646s1c1
Sequence:CCGGGCCTTTCTCATTCGGGAAAGCCTCGAGGCTTTCCCGAATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005248
FGR MISSION shRNA Lentiviral Transduction Particles
feline Gardner-Rasheed sarcoma viral oncogene homolog
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.x-2247s1c1
Sequence:CCGGCCAGGTTTGAGGGAGAAGTTTCTCGAGAAACTTCTCCCTCAAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-1529s1c1
Sequence:CCGGGCATGAATAAACGGGAAGTGTCTCGAGACACTTCCCGTTTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-460s1c1
Sequence:CCGGCACATCCTGAACAATACTGAACTCGAGTTCAGTATTGTTCAGGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-385s1c1
Sequence:CCGGACCCTGTTCATTGCCCTGTATCTCGAGATACAGGGCAATGAACAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.x-339s1c1
Sequence:CCGGCTTCCTTGATAGTGGCACCATCTCGAGATGGTGCCACTATCAAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-386s1c1
Sequence:CCGGCCCTGTTCATTGCCCTGTATGCTCGAGCATACAGGGCAATGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1267s1c1
Sequence:CCGGGAACGCATGAACTACATTCACCTCGAGGTGAATGTAGTTCATGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005248.1-2145s1c1
Sequence:CCGGCCCTCTATTCTCTTGTGTCTGCTCGAGCAGACACAAGAGAATAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-1330s1c1
Sequence:CCGGGCGTGCAAGATCGCAGACTTTCTCGAGAAAGTCTGCGATCTTGCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005248.1-646s1c1
Sequence:CCGGGCCTTTCTCATTCGGGAAAGCCTCGAGGCTTTCCCGAATGAGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010208
FGR MISSION shRNA Bacterial Glycerol Stock
feline Gardner-Rasheed sarcoma viral oncogene homolog
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-853s1c1
Sequence:CCGGCGGCACTACATGGAAGTGAATCTCGAGATTCACTTCCATGTAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-758s1c1
Sequence:CCGGGCGATCACATAAAGCATTATACTCGAGTATAATGCTTTATGTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-618s1c1
Sequence:CCGGCTTCGGAAAGATCAGTAGAAACTCGAGTTTCTACTGATCTTTCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-1708s1c1
Sequence:CCGGCAGTCTTTCCTGGAAGACTATCTCGAGATAGTCTTCCAGGAAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-328s21c1
Sequence:CCGGACGGCTGAAGAACGCTATTTCCTCGAGGAAATAGCGTTCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-1330s21c1
Sequence:CCGGATGGAACGCATGAACTATATCCTCGAGGATATAGTTCATGCGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010208.4-2187s21c1
Sequence:CCGGTCATCCTTTGTCTAGTTATTTCTCGAGAAATAACTAGACAAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010208
FGR MISSION shRNA shRNA Plasmid DNA
feline Gardner-Rasheed sarcoma viral oncogene homolog
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-853s1c1
Sequence:CCGGCGGCACTACATGGAAGTGAATCTCGAGATTCACTTCCATGTAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-758s1c1
Sequence:CCGGGCGATCACATAAAGCATTATACTCGAGTATAATGCTTTATGTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-618s1c1
Sequence:CCGGCTTCGGAAAGATCAGTAGAAACTCGAGTTTCTACTGATCTTTCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-1708s1c1
Sequence:CCGGCAGTCTTTCCTGGAAGACTATCTCGAGATAGTCTTCCAGGAAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-328s21c1
Sequence:CCGGACGGCTGAAGAACGCTATTTCCTCGAGGAAATAGCGTTCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-1330s21c1
Sequence:CCGGATGGAACGCATGAACTATATCCTCGAGGATATAGTTCATGCGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010208.4-2187s21c1
Sequence:CCGGTCATCCTTTGTCTAGTTATTTCTCGAGAAATAACTAGACAAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010208
FGR MISSION shRNA Lentiviral Transduction Particles
feline Gardner-Rasheed sarcoma viral oncogene homolog
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-853s1c1
Sequence:CCGGCGGCACTACATGGAAGTGAATCTCGAGATTCACTTCCATGTAGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-758s1c1
Sequence:CCGGGCGATCACATAAAGCATTATACTCGAGTATAATGCTTTATGTGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-618s1c1
Sequence:CCGGCTTCGGAAAGATCAGTAGAAACTCGAGTTTCTACTGATCTTTCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010208.2-1708s1c1
Sequence:CCGGCAGTCTTTCCTGGAAGACTATCTCGAGATAGTCTTCCAGGAAAGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-328s21c1
Sequence:CCGGACGGCTGAAGAACGCTATTTCCTCGAGGAAATAGCGTTCTTCAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010208.4-1330s21c1
Sequence:CCGGATGGAACGCATGAACTATATCCTCGAGGATATAGTTCATGCGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010208.4-2187s21c1
Sequence:CCGGTCATCCTTTGTCTAGTTATTTCTCGAGAAATAACTAGACAAAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks