EMAIL THIS PAGE TO A FRIEND

FH

fumarate hydratase

50 Gene Product Result for
Synonyms: HLRCC LRCC MCL MCUL1
UniProtKB ID: P07954
Gene ID:
Human(2271) Summary: The protein encoded by this gene is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. It is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. [provided by RefSeq, Jul 2008]
Mouse(14193) fetal hematoma
Rat(24368) fumarate hydratase
sheep(100302102) fumarate hydratase
naked mole-rat(101715373) fumarate hydratase
domestic guinea pig(100723287) fumarate hydratase
Zebrafish(393938) fumarate hydratase
chicken(420969) fumarate hydratase
fruit fly(31845) frataxin homolog
dog(480092) fumarate hydratase
Horse(100060381) fumarate hydratase
cow(520260) fumarate hydratase
domestic cat(101096029) fumarate hydratase
Gene Class: Dehydratase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F4681 Anti-FH (46-60) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F9305 Anti-FH (491-505) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F4806 Anti-FH (496-510) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F9180 Anti-FH (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA025770 Anti-FH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA025948 Anti-FH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry, western blot pricing
HPA027341 Anti-FH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 mouse, rat, human
immunohistochemistry, western blot pricing
SAB2500433 Anti-Fumarase/FH antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, rat, mouse
ELISA, western blot pricing
WH0002271M7 Monoclonal Anti-FH antibody produced in mouse clone 5C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403819 Monoclonal Anti-FH, (C-terminal) antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

Kits

Product # Description Species Add to Cart
 
MAK206 Fumarase Activity Colorimetric Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000143 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137741 MISSION® esiRNA esiRNA human FH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000143 Rosetta Predictions human pricing
NM_017005 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037389 predicted 464
2 SASI_Hs01_00037390 predicted 201
3 SASI_Hs01_00037391 predicted 698
4 SASI_Hs01_00037392 predicted 1344
5 SASI_Hs01_00037393 predicted 877
6 SASI_Hs01_00037394 predicted 367
7 SASI_Hs01_00037395 predicted 246
8 SASI_Hs01_00037396 predicted 714
9 SASI_Hs01_00037397 predicted 643
10 SASI_Hs02_00301958 predicted 241
11 SASI_Hs01_00037398 predicted 1310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115571 predicted 446
2 SASI_Rn01_00115572 predicted 345
3 SASI_Rn01_00115573 predicted 1000
4 SASI_Rn01_00115574 predicted 274
5 SASI_Rn01_00115575 predicted 200
6 SASI_Rn01_00115576 predicted 1336
7 SASI_Rn02_00261157 predicted 726
8 SASI_Rn01_00115577 predicted 925
9 SASI_Rn01_00115578 predicted 1332
10 SASI_Rn01_00115579 predicted 1018
11 SASI_Rn01_00115580 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000143
VALIDATED
FH MISSION shRNA Bacterial Glycerol Stock
fumarate hydratase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-561s21c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-341s21c1
Sequence:CCGGCGCTGAAGTAAACCAGGATTACTCGAGTAATCCTGGTTTACTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-778s21c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-182s21c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-182s1c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-778s1c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-561s1c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000143
VALIDATED
FH MISSION shRNA shRNA Plasmid DNA
fumarate hydratase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-561s21c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-341s21c1
Sequence:CCGGCGCTGAAGTAAACCAGGATTACTCGAGTAATCCTGGTTTACTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-778s21c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-182s21c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-182s1c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-778s1c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-561s1c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000143
VALIDATED
FH MISSION shRNA Lentiviral Transduction Particles
fumarate hydratase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-561s21c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-341s21c1
Sequence:CCGGCGCTGAAGTAAACCAGGATTACTCGAGTAATCCTGGTTTACTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-778s21c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000143.2-182s21c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-182s1c1
Sequence:CCGGCCGGATAGAATATGATACCTTCTCGAGAAGGTATCATATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-778s1c1
Sequence:CCGGGTGGTTATGTTCAACAAGTAACTCGAGTTACTTGTTGAACATAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000143.2-561s1c1
Sequence:CCGGCCCAACGATCATGTTAATAAACTCGAGTTTATTAACATGATCGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks