EMAIL THIS PAGE TO A FRIEND

FHAD1

forkhead-associated (FHA) phosphopeptide binding domain 1

213 Gene Product Result for
UniProtKB ID: B1AJZ9, Q0P6F5, Q8N8D3, Q8N9T6, Q8NA05
Gene ID:
Mouse(329977) forkhead-associated (FHA) phosphopeptide binding domain 1
Rat(500577) forkhead-associated (FHA) phosphopeptide binding domain 1
chicken(771744) forkhead-associated (FHA) phosphopeptide binding domain 1
domestic cat(101082929) forkhead-associated (FHA) phosphopeptide binding domain 1
cow(512520) forkhead-associated (FHA) phosphopeptide binding domain 1
dog(478221) forkhead-associated (FHA) phosphopeptide binding domain 1
sheep(101110161) forkhead-associated (FHA) phosphopeptide binding domain 1
domestic guinea pig(100716370) forkhead-associated (FHA) phosphopeptide binding domain 1
naked mole-rat(101723242) forkhead-associated (FHA) phosphopeptide binding domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052929 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU201391 MISSION® esiRNA esiRNA targeting mouse Fhad1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052929 Rosetta Predictions human pricing
XM_057107 Rosetta Predictions human pricing
XM_934876 Rosetta Predictions human pricing
XM_934878 Rosetta Predictions human pricing
XM_934881 Rosetta Predictions human pricing
XM_934883 Rosetta Predictions human pricing
XM_934885 Rosetta Predictions human pricing
XM_934887 Rosetta Predictions human pricing
XM_934889 Rosetta Predictions human pricing
XM_934890 Rosetta Predictions human pricing
XM_934892 Rosetta Predictions human pricing
NM_001044268 Rosetta Predictions rat pricing
NM_028429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361700 predicted 3156
2 SASI_Hs02_00361701 predicted 1299
3 SASI_Hs02_00361702 predicted 2617
4 SASI_Hs02_00361703 predicted 3103
5 SASI_Hs02_00361704 predicted 3769
6 SASI_Hs02_00361705 predicted 1528
7 SASI_Hs02_00361706 predicted 3087
8 SASI_Hs02_00361707 predicted 1209
9 SASI_Hs02_00361708 predicted 3565
10 SASI_Hs02_00361709 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_057107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271815 predicted 2132
2 SASI_Hs01_00271816 predicted 307
3 SASI_Hs01_00271817 predicted 2070
4 SASI_Hs01_00271818 predicted 2750
5 SASI_Hs01_00271819 predicted 551
6 SASI_Hs01_00271820 predicted 2066
7 SASI_Hs01_00271821 predicted 1509
8 SASI_Hs01_00271822 predicted 2709
9 SASI_Hs01_00271823 predicted 629
10 SASI_Hs01_00271824 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264684 predicted 782
2 SASI_Hs01_00264685 predicted 978
3 SASI_Hs01_00264686 predicted 486
4 SASI_Hs01_00264687 predicted 773
5 SASI_Hs01_00264688 predicted 498
6 SASI_Hs01_00264689 predicted 505
7 SASI_Hs01_00264690 predicted 874
8 SASI_Hs01_00264691 predicted 824
9 SASI_Hs01_00264692 predicted 592
10 SASI_Hs01_00264693 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249737 predicted 1110
2 SASI_Hs01_00249738 predicted 1395
3 SASI_Hs01_00249739 predicted 1096
4 SASI_Hs01_00249740 predicted 1739
5 SASI_Hs01_00249741 predicted 1055
6 SASI_Hs01_00249742 predicted 1017
7 SASI_Hs01_00249743 predicted 911
8 SASI_Hs01_00249744 predicted 1847
9 SASI_Hs01_00249745 predicted 1896
10 SASI_Hs01_00249746 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249789 predicted 1559
2 SASI_Hs01_00249790 predicted 1554
3 SASI_Hs01_00249791 predicted 1016
4 SASI_Hs01_00249792 predicted 1500
5 SASI_Hs01_00249793 predicted 2167
6 SASI_Hs01_00249794 predicted 1487
7 SASI_Hs01_00249795 predicted 928
8 SASI_Hs01_00249796 predicted 1965
9 SASI_Hs01_00249797 predicted 2135
10 SASI_Hs01_00249798 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296862 predicted 2136
2 SASI_Hs01_00296863 predicted 317
3 SASI_Hs01_00296864 predicted 2071
4 SASI_Hs01_00296865 predicted 2749
5 SASI_Hs01_00296866 predicted 543
6 SASI_Hs01_00296867 predicted 2066
7 SASI_Hs01_00296868 predicted 1506
8 SASI_Hs01_00296869 predicted 2712
9 SASI_Hs01_00296870 predicted 630
10 SASI_Hs01_00296871 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287610 predicted 2136
2 SASI_Hs01_00287611 predicted 314
3 SASI_Hs01_00287612 predicted 2074
4 SASI_Hs01_00287613 predicted 2751
5 SASI_Hs01_00287614 predicted 551
6 SASI_Hs01_00287615 predicted 2060
7 SASI_Hs01_00287616 predicted 1508
8 SASI_Hs01_00287617 predicted 2707
9 SASI_Hs01_00287618 predicted 632
10 SASI_Hs01_00287619 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281393 predicted 363
2 SASI_Hs01_00281394 predicted 370
3 SASI_Hs01_00281395 predicted 541
4 SASI_Hs01_00281396 predicted 361
5 SASI_Hs01_00281397 predicted 278
6 SASI_Hs01_00281398 predicted 270
7 SASI_Hs01_00281399 predicted 270
8 SASI_Hs01_00281400 predicted 297
9 SASI_Hs01_00281401 predicted 404
10 SASI_Hs01_00281402 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259429 predicted 2128
2 SASI_Hs01_00259430 predicted 316
3 SASI_Hs01_00259431 predicted 2076
4 SASI_Hs01_00259432 predicted 2746
5 SASI_Hs01_00259433 predicted 541
6 SASI_Hs01_00259434 predicted 2057
7 SASI_Hs01_00259435 predicted 1502
8 SASI_Hs01_00259436 predicted 2539
9 SASI_Hs01_00259437 predicted 2715
10 SASI_Hs01_00259438 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249555 predicted 234
2 SASI_Hs01_00249556 predicted 306
3 SASI_Hs01_00249557 predicted 147
4 SASI_Hs01_00249558 predicted 262
5 SASI_Hs01_00249559 predicted 287
6 SASI_Hs01_00249560 predicted 143
7 SASI_Hs01_00249561 predicted 233
8 SASI_Hs01_00249562 predicted 215
9 SASI_Hs01_00249563 predicted 276
10 SASI_Hs01_00249564 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293350 predicted 2132
2 SASI_Hs01_00293351 predicted 309
3 SASI_Hs01_00293352 predicted 2070
4 SASI_Hs01_00293353 predicted 547
5 SASI_Hs01_00293354 predicted 2065
6 SASI_Hs01_00293355 predicted 1502
7 SASI_Hs01_00293356 predicted 2715
8 SASI_Hs01_00293357 predicted 3383
9 SASI_Hs01_00293358 predicted 633
10 SASI_Hs01_00293359 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205354 predicted 1849
2 SASI_Rn02_00205355 predicted 1958
3 SASI_Rn02_00205356 predicted 1794
4 SASI_Rn02_00205357 predicted 1257
5 SASI_Rn02_00205358 predicted 1478
6 SASI_Rn02_00205359 predicted 1024
7 SASI_Rn02_00205360 predicted 452
8 SASI_Rn02_00205361 predicted 1479
9 SASI_Rn02_00205362 predicted 897
10 SASI_Rn02_00205363 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020982 predicted 348
2 SASI_Mm01_00020983 predicted 281
3 SASI_Mm01_00020984 predicted 260
4 SASI_Mm01_00020985 predicted 348
5 SASI_Mm01_00020986 predicted 522
6 SASI_Mm01_00020987 predicted 308
7 SASI_Mm01_00020988 predicted 422
8 SASI_Mm01_00020989 predicted 411
9 SASI_Mm01_00020990 predicted 270
10 SASI_Mm01_00020991 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052929
FHAD1 MISSION shRNA Bacterial Glycerol Stock
forkhead-associated (FHA) phosphopeptide binding domain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3603s21c1
Sequence:CCGGTGAACTTCGAGCGCGAATTAACTCGAGTTAATTCGCGCTCGAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3637s21c1
Sequence:CCGGGCGCGCTCACCAGATCATAAACTCGAGTTTATGATCTGGTGAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-1562s21c1
Sequence:CCGGGGAACAGAGAGAGCGTCATTACTCGAGTAATGACGCTCTCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052929.1-4583s21c1
Sequence:CCGGGTACACGAACTCAGGTATATGCTCGAGCATATACCTGAGTTCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-878s21c1
Sequence:CCGGCCAAATACAAAGACGTCATAACTCGAGTTATGACGTCTTTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052929
FHAD1 MISSION shRNA shRNA Plasmid DNA
forkhead-associated (FHA) phosphopeptide binding domain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3603s21c1
Sequence:CCGGTGAACTTCGAGCGCGAATTAACTCGAGTTAATTCGCGCTCGAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3637s21c1
Sequence:CCGGGCGCGCTCACCAGATCATAAACTCGAGTTTATGATCTGGTGAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-1562s21c1
Sequence:CCGGGGAACAGAGAGAGCGTCATTACTCGAGTAATGACGCTCTCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052929.1-4583s21c1
Sequence:CCGGGTACACGAACTCAGGTATATGCTCGAGCATATACCTGAGTTCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-878s21c1
Sequence:CCGGCCAAATACAAAGACGTCATAACTCGAGTTATGACGTCTTTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052929
FHAD1 MISSION shRNA Lentiviral Transduction Particles
forkhead-associated (FHA) phosphopeptide binding domain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3603s21c1
Sequence:CCGGTGAACTTCGAGCGCGAATTAACTCGAGTTAATTCGCGCTCGAAGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-3637s21c1
Sequence:CCGGGCGCGCTCACCAGATCATAAACTCGAGTTTATGATCTGGTGAGCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-1562s21c1
Sequence:CCGGGGAACAGAGAGAGCGTCATTACTCGAGTAATGACGCTCTCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052929.1-4583s21c1
Sequence:CCGGGTACACGAACTCAGGTATATGCTCGAGCATATACCTGAGTTCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052929.1-878s21c1
Sequence:CCGGCCAAATACAAAGACGTCATAACTCGAGTTATGACGTCTTTGTATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177868
FHAD1 MISSION shRNA Bacterial Glycerol Stock
forkhead-associated (FHA) phosphopeptide binding domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177868.2-1852s1c1
Sequence:CCGGCCAGCAAGATGCTCAGACTAACTCGAGTTAGTCTGAGCATCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-428s1c1
Sequence:CCGGCGTCTTACAGTCCGCAGATATCTCGAGATATCTGCGGACTGTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1692s1c1
Sequence:CCGGCGTGCTTCAAGGAAGCTTGATCTCGAGATCAAGCTTCCTTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1370s1c1
Sequence:CCGGGACATCTTTACAGAAAGACATCTCGAGATGTCTTTCTGTAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1498s1c1
Sequence:CCGGCAGTGATGAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177868
FHAD1 MISSION shRNA shRNA Plasmid DNA
forkhead-associated (FHA) phosphopeptide binding domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177868.2-1852s1c1
Sequence:CCGGCCAGCAAGATGCTCAGACTAACTCGAGTTAGTCTGAGCATCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-428s1c1
Sequence:CCGGCGTCTTACAGTCCGCAGATATCTCGAGATATCTGCGGACTGTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1692s1c1
Sequence:CCGGCGTGCTTCAAGGAAGCTTGATCTCGAGATCAAGCTTCCTTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1370s1c1
Sequence:CCGGGACATCTTTACAGAAAGACATCTCGAGATGTCTTTCTGTAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1498s1c1
Sequence:CCGGCAGTGATGAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177868
FHAD1 MISSION shRNA Lentiviral Transduction Particles
forkhead-associated (FHA) phosphopeptide binding domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093399    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177868.2-1852s1c1
Sequence:CCGGCCAGCAAGATGCTCAGACTAACTCGAGTTAGTCTGAGCATCTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-428s1c1
Sequence:CCGGCGTCTTACAGTCCGCAGATATCTCGAGATATCTGCGGACTGTAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1692s1c1
Sequence:CCGGCGTGCTTCAAGGAAGCTTGATCTCGAGATCAAGCTTCCTTGAAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1370s1c1
Sequence:CCGGGACATCTTTACAGAAAGACATCTCGAGATGTCTTTCTGTAAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177868.2-1498s1c1
Sequence:CCGGCAGTGATGAAAGAAGAGCTAACTCGAGTTAGCTCTTCTTTCATCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks