EMAIL THIS PAGE TO A FRIEND

FHDC1

FH2 domain containing 1

65 Gene Product Result for
UniProtKB ID: Q9C0D6
Gene ID:
Mouse(229474) FH2 domain containing 1
Rat(295161) FH2 domain containing 1
Domestic Rabbit(100355471) FH2 domain containing 1
naked mole-rat(101701837) FH2 domain containing 1
domestic guinea pig(100717865) FH2 domain containing 1
Zebrafish(100148864) formin homology domain containing 1
cow(784913) FH2 domain containing 1
Horse(100070163) FH2 domain containing 1
chicken(422484) FH2 domain containing 1
dog(482650) FH2 domain containing 1
domestic cat(101094844) FH2 domain containing 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033393 Rosetta Predictions human pricing
NM_001106437 Rosetta Predictions rat pricing
NM_001033301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015395 predicted 2874
2 SASI_Hs01_00015396 predicted 3568
3 SASI_Hs01_00015397 predicted 592
4 SASI_Hs01_00015399 predicted 848
5 SASI_Hs02_00361258 predicted 780
6 SASI_Hs01_00015400 predicted 799
7 SASI_Hs01_00015402 predicted 3474
8 SASI_Hs01_00015403 predicted 745
9 SASI_Hs01_00015404 predicted 830
10 SASI_Hs02_00361259 predicted 2658
11 SASI_Hs01_00015398 predicted 1124
12 SASI_Hs01_00015401 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218948 predicted 1593
2 SASI_Rn02_00218949 predicted 2310
3 SASI_Rn02_00218950 predicted 783
4 SASI_Rn02_00218951 predicted 1097
5 SASI_Rn02_00218952 predicted 1259
6 SASI_Rn02_00218953 predicted 3584
7 SASI_Rn02_00218954 predicted 1358
8 SASI_Rn02_00218955 predicted 2244
9 SASI_Rn02_00218956 predicted 1303
10 SASI_Rn02_00218957 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113285 predicted 1532
2 SASI_Mm01_00113286 predicted 716
3 SASI_Mm01_00113287 predicted 3723
4 SASI_Mm01_00113288 predicted 1199
5 SASI_Mm01_00113289 predicted 771
6 SASI_Mm01_00113290 predicted 3521
7 SASI_Mm01_00113291 predicted 1282
8 SASI_Mm01_00113292 predicted 2182
9 SASI_Mm01_00113294 predicted 1698
10 SASI_Mm02_00288503 predicted 2491
11 SASI_Mm01_00113293 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033301
VALIDATED
FHDC1 MISSION shRNA Bacterial Glycerol Stock
FH2 domain containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033301.1-3726s1c1
Sequence:CCGGCCAGTCTTAAACATCTTGTTACTCGAGTAACAAGATGTTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-2267s1c1
Sequence:CCGGCCAACTGACTCTGAATGACTTCTCGAGAAGTCATTCAGAGTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3838s1c1
Sequence:CCGGCGAAATCAAAGCTGAGAGTATCTCGAGATACTCTCAGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-1201s1c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-1256s1c1
Sequence:CCGGCCTTCTAAACTTCTCTGAGAACTCGAGTTCTCAGAGAAGTTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3725s1c1
Sequence:CCGGGCCAGTCTTAAACATCTTGTTCTCGAGAACAAGATGTTTAAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033301.3-774s1c1
Sequence:CCGGCCATCGTAGAGGATATCTATCCTCGAGGATAGATATCCTCTACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-725s21c1
Sequence:CCGGAGTATGAACATTGGCATATTTCTCGAGAAATATGCCAATGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-3775s21c1
Sequence:CCGGCTTAAAGGTCACGTCACTAAACTCGAGTTTAGTGACGTGACCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1286s21c1
Sequence:CCGGGTGCAAGAGACATCGAGATTACTCGAGTAATCTCGATGTCTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1134s21c1
Sequence:CCGGCCGGCAATGCCGTAGGATTTACTCGAGTAAATCCTACGGCATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1200s21c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033301
VALIDATED
FHDC1 MISSION shRNA shRNA Plasmid DNA
FH2 domain containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033301.1-3726s1c1
Sequence:CCGGCCAGTCTTAAACATCTTGTTACTCGAGTAACAAGATGTTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-2267s1c1
Sequence:CCGGCCAACTGACTCTGAATGACTTCTCGAGAAGTCATTCAGAGTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3838s1c1
Sequence:CCGGCGAAATCAAAGCTGAGAGTATCTCGAGATACTCTCAGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-1201s1c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-1256s1c1
Sequence:CCGGCCTTCTAAACTTCTCTGAGAACTCGAGTTCTCAGAGAAGTTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3725s1c1
Sequence:CCGGGCCAGTCTTAAACATCTTGTTCTCGAGAACAAGATGTTTAAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033301.3-774s1c1
Sequence:CCGGCCATCGTAGAGGATATCTATCCTCGAGGATAGATATCCTCTACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-725s21c1
Sequence:CCGGAGTATGAACATTGGCATATTTCTCGAGAAATATGCCAATGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-3775s21c1
Sequence:CCGGCTTAAAGGTCACGTCACTAAACTCGAGTTTAGTGACGTGACCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1286s21c1
Sequence:CCGGGTGCAAGAGACATCGAGATTACTCGAGTAATCTCGATGTCTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1134s21c1
Sequence:CCGGCCGGCAATGCCGTAGGATTTACTCGAGTAAATCCTACGGCATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1200s21c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033301
VALIDATED
FHDC1 MISSION shRNA Lentiviral Transduction Particles
FH2 domain containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033301.1-3726s1c1
Sequence:CCGGCCAGTCTTAAACATCTTGTTACTCGAGTAACAAGATGTTTAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-2267s1c1
Sequence:CCGGCCAACTGACTCTGAATGACTTCTCGAGAAGTCATTCAGAGTCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179970    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3838s1c1
Sequence:CCGGCGAAATCAAAGCTGAGAGTATCTCGAGATACTCTCAGCTTTGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-1201s1c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033301.1-1256s1c1
Sequence:CCGGCCTTCTAAACTTCTCTGAGAACTCGAGTTCTCAGAGAAGTTTAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033301.1-3725s1c1
Sequence:CCGGGCCAGTCTTAAACATCTTGTTCTCGAGAACAAGATGTTTAAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033301.3-774s1c1
Sequence:CCGGCCATCGTAGAGGATATCTATCCTCGAGGATAGATATCCTCTACGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-725s21c1
Sequence:CCGGAGTATGAACATTGGCATATTTCTCGAGAAATATGCCAATGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-3775s21c1
Sequence:CCGGCTTAAAGGTCACGTCACTAAACTCGAGTTTAGTGACGTGACCTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1286s21c1
Sequence:CCGGGTGCAAGAGACATCGAGATTACTCGAGTAATCTCGATGTCTCTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1134s21c1
Sequence:CCGGCCGGCAATGCCGTAGGATTTACTCGAGTAAATCCTACGGCATTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033301.3-1200s21c1
Sequence:CCGGCTGGAATGAATCTTCTGCATTCTCGAGAATGCAGAAGATTCATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033393
FHDC1 MISSION shRNA Bacterial Glycerol Stock
FH2 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033393.1-4869s1c1
Sequence:CCGGCCCTGGTAGAATGCTGGATTTCTCGAGAAATCCAGCATTCTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-844s1c1
Sequence:CCGGGCCATGGTGCTAAAGAAGGAACTCGAGTTCCTTCTTTAGCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-819s1c1
Sequence:CCGGGCCAAACTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-643s1c1
Sequence:CCGGCGGTCCATTGTAGAAGATATTCTCGAGAATATCTTCTACAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-595s1c1
Sequence:CCGGCGGAGCATGAACATTGGGATACTCGAGTATCCCAATGTTCATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-2068s21c1
Sequence:CCGGCCATTGGCTCTGGGAATTAAGCTCGAGCTTAATTCCCAGAGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-1159s21c1
Sequence:CCGGGTTCAGAAGACTGCTAGATTACTCGAGTAATCTAGCAGTCTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-451s21c1
Sequence:CCGGCACTACCAAATTGATACAAAGCTCGAGCTTTGTATCAATTTGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033393
FHDC1 MISSION shRNA shRNA Plasmid DNA
FH2 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033393.1-4869s1c1
Sequence:CCGGCCCTGGTAGAATGCTGGATTTCTCGAGAAATCCAGCATTCTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-844s1c1
Sequence:CCGGGCCATGGTGCTAAAGAAGGAACTCGAGTTCCTTCTTTAGCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-819s1c1
Sequence:CCGGGCCAAACTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-643s1c1
Sequence:CCGGCGGTCCATTGTAGAAGATATTCTCGAGAATATCTTCTACAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-595s1c1
Sequence:CCGGCGGAGCATGAACATTGGGATACTCGAGTATCCCAATGTTCATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-2068s21c1
Sequence:CCGGCCATTGGCTCTGGGAATTAAGCTCGAGCTTAATTCCCAGAGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-1159s21c1
Sequence:CCGGGTTCAGAAGACTGCTAGATTACTCGAGTAATCTAGCAGTCTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-451s21c1
Sequence:CCGGCACTACCAAATTGATACAAAGCTCGAGCTTTGTATCAATTTGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033393
FHDC1 MISSION shRNA Lentiviral Transduction Particles
FH2 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116242    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033393.1-4869s1c1
Sequence:CCGGCCCTGGTAGAATGCTGGATTTCTCGAGAAATCCAGCATTCTACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-844s1c1
Sequence:CCGGGCCATGGTGCTAAAGAAGGAACTCGAGTTCCTTCTTTAGCACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-819s1c1
Sequence:CCGGGCCAAACTATTCACTTCGGATCTCGAGATCCGAAGTGAATAGTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-643s1c1
Sequence:CCGGCGGTCCATTGTAGAAGATATTCTCGAGAATATCTTCTACAATGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033393.1-595s1c1
Sequence:CCGGCGGAGCATGAACATTGGGATACTCGAGTATCCCAATGTTCATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-2068s21c1
Sequence:CCGGCCATTGGCTCTGGGAATTAAGCTCGAGCTTAATTCCCAGAGCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-1159s21c1
Sequence:CCGGGTTCAGAAGACTGCTAGATTACTCGAGTAATCTAGCAGTCTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033393.2-451s21c1
Sequence:CCGGCACTACCAAATTGATACAAAGCTCGAGCTTTGTATCAATTTGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks