EMAIL THIS PAGE TO A FRIEND

FHIT

fragile histidine triad

69 Gene Product Result for
Synonyms: AP3Aase FRA3B
UniProtKB ID: P49789, Q6IU12
Gene ID:
Human(2272) Summary: This gene, a member of the histidine triad gene family, encodes a diadenosine 5',5'''-P1,P3-triphosphate hydrolase involved in purine metabolism. The gene encompasses the common fragile site FRA3B on chromosome 3, where carcinogen-induced damage can lead to translocations and aberrant transcripts of this gene. In fact, aberrant transcripts from this gene have been found in about half of all esophageal, stomach, and colon carcinomas. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(14198) fragile histidine triad gene
Rat(60398) fragile histidine triad
Zebrafish(393713) fragile histidine triad gene
chicken(416071) fragile histidine triad
Thale Cress(835936) fragile histidine triad protein
cow(692183) fragile histidine triad gene
domestic cat(101082731) fragile histidine triad
dog(100215999) fragile histidine triad
sheep(100307043) fragile histidine triad
domestic guinea pig(100735806) fragile histidine triad
naked mole-rat(101720165) fragile histidine triad
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F9430 Anti-FHIT (41-55) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1411944 ANTI-FHIT antibody produced in mouse clone 1A2, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411945 ANTI-FHIT antibody produced in mouse clone 3D3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411946 ANTI-FHIT antibody produced in mouse clone 1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411947 ANTI-FHIT antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411948 ANTI-FHIT antibody produced in mouse clone 3A5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412147 ANTI-FHIT antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412148 ANTI-FHIT antibody produced in mouse clone 2G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA018840 Anti-FHIT antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA018909 Anti-FHIT antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4500892 Anti-FHIT antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1105217 Anti-phospho-FHIT (pThr114) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4504740 Anti-phospho-FHIT (pTyr114) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
WH0002272M1 Monoclonal Anti-FHIT antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403820 Monoclonal Anti-FHIT antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002012 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002012 Rosetta Predictions human pricing
NM_021774 Rosetta Predictions rat pricing
NM_010210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185824 predicted 458
2 SASI_Hs01_00185829 predicted 397
3 SASI_Hs02_00333009 predicted 558
4 SASI_Hs01_00185831 predicted 527
5 SASI_Hs01_00185833 predicted 532
6 SASI_Hs02_00333010 predicted 530
7 SASI_Hs02_00333011 predicted 457
8 SASI_Hs02_00333012 predicted 466
9 SASI_Hs01_00185825 predicted 432
10 SASI_Hs01_00185826 predicted 427
11 SASI_Hs01_00185827 predicted 521
12 SASI_Hs01_00185828 predicted 493
13 SASI_Hs01_00185830 predicted 366
14 SASI_Hs01_00185832 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021774 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039507 predicted 309
2 SASI_Rn01_00039508 predicted 226
3 SASI_Rn01_00039509 predicted 293
4 SASI_Rn01_00039510 predicted 313
5 SASI_Rn01_00039511 predicted 379
6 SASI_Rn01_00039512 predicted 250
7 SASI_Rn01_00039514 predicted 303
8 SASI_Rn01_00039515 predicted 288
9 SASI_Rn01_00039516 predicted 328
10 SASI_Rn02_00262833 predicted 197
11 SASI_Rn01_00039513 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097712 predicted 678
2 SASI_Mm01_00097713 predicted 476
3 SASI_Mm01_00097714 predicted 700
4 SASI_Mm01_00097715 predicted 513
5 SASI_Mm01_00097716 predicted 398
6 SASI_Mm02_00318039 predicted 739
7 SASI_Mm02_00318040 predicted 761
8 SASI_Mm01_00097717 predicted 669
9 SASI_Mm01_00097718 predicted 434
10 SASI_Mm01_00097719 predicted 670
11 SASI_Mm01_00097720 predicted 688
12 SASI_Mm01_00097721 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010210
FHIT MISSION shRNA Bacterial Glycerol Stock
fragile histidine triad
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-400s21c1
Sequence:CCGGGGCCGATTTGTTTCAAGTGACCTCGAGGTCACTTGAAACAAATCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-686s21c1
Sequence:CCGGTGAGAGTAACTCAAACGATTCCTCGAGGAATCGTTTGAGTTACTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010210.2-758s21c1
Sequence:CCGGATGAAGCTAACCACTCTTTATCTCGAGATAAAGAGTGGTTAGCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010210.1-911s1c1
Sequence:CCGGGCCTTGTACAAAGAACTTTATCTCGAGATAAAGTTCTTTGTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-673s1c1
Sequence:CCGGCGGAATGACAACATCTATGATCTCGAGATCATAGATGTTGTCATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-424s1c1
Sequence:CCGGGTGAATAGGAAACCCGTTGTACTCGAGTACAACGGGTTTCCTATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-616s1c1
Sequence:CCGGCAGACTGTGAAGCATGTACATCTCGAGATGTACATGCTTCACAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-490s1c1
Sequence:CCGGCGTGACCTACATCCTGATGAACTCGAGTTCATCAGGATGTAGGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010210
FHIT MISSION shRNA shRNA Plasmid DNA
fragile histidine triad
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-400s21c1
Sequence:CCGGGGCCGATTTGTTTCAAGTGACCTCGAGGTCACTTGAAACAAATCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-686s21c1
Sequence:CCGGTGAGAGTAACTCAAACGATTCCTCGAGGAATCGTTTGAGTTACTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010210.2-758s21c1
Sequence:CCGGATGAAGCTAACCACTCTTTATCTCGAGATAAAGAGTGGTTAGCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010210.1-911s1c1
Sequence:CCGGGCCTTGTACAAAGAACTTTATCTCGAGATAAAGTTCTTTGTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-673s1c1
Sequence:CCGGCGGAATGACAACATCTATGATCTCGAGATCATAGATGTTGTCATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-424s1c1
Sequence:CCGGGTGAATAGGAAACCCGTTGTACTCGAGTACAACGGGTTTCCTATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-616s1c1
Sequence:CCGGCAGACTGTGAAGCATGTACATCTCGAGATGTACATGCTTCACAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-490s1c1
Sequence:CCGGCGTGACCTACATCCTGATGAACTCGAGTTCATCAGGATGTAGGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010210
FHIT MISSION shRNA Lentiviral Transduction Particles
fragile histidine triad
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-400s21c1
Sequence:CCGGGGCCGATTTGTTTCAAGTGACCTCGAGGTCACTTGAAACAAATCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010210.2-686s21c1
Sequence:CCGGTGAGAGTAACTCAAACGATTCCTCGAGGAATCGTTTGAGTTACTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427007    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010210.2-758s21c1
Sequence:CCGGATGAAGCTAACCACTCTTTATCTCGAGATAAAGAGTGGTTAGCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010210.1-911s1c1
Sequence:CCGGGCCTTGTACAAAGAACTTTATCTCGAGATAAAGTTCTTTGTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-673s1c1
Sequence:CCGGCGGAATGACAACATCTATGATCTCGAGATCATAGATGTTGTCATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-424s1c1
Sequence:CCGGGTGAATAGGAAACCCGTTGTACTCGAGTACAACGGGTTTCCTATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-616s1c1
Sequence:CCGGCAGACTGTGAAGCATGTACATCTCGAGATGTACATGCTTCACAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010210.1-490s1c1
Sequence:CCGGCGTGACCTACATCCTGATGAACTCGAGTTCATCAGGATGTAGGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002012
VALIDATED
FHIT MISSION shRNA Bacterial Glycerol Stock
fragile histidine triad
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-853s21c1
Sequence:GTACCGGGCTATTGCCAACCAGTTTGAACTCGAGTTCAAACTGGTTGGCAATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-433s21c1
Sequence:GTACCGGTGTCCTTCGCTCTTGTGAATACTCGAGTATTCACAAGAGCGAAGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-708s21c1
Sequence:GTACCGGATCTATGAGGAGCTCCAGAAACTCGAGTTTCTGGAGCTCCTCATAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-681s21c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-405s21c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-930s21c1
Sequence:CCGGTCATCTCACCATCCTGTATTCCTCGAGGAATACAGGATGGTGAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-591s21c1
Sequence:CCGGCATGGGACCTCTCTCACCTTTCTCGAGAAAGGTGAGAGAGGTCCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-652s21c1
Sequence:CCGGACGTTCACGTCCATGTTCTTCCTCGAGGAAGAACATGGACGTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-672s1c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-745s1c1
Sequence:CCGGCTTGGAGATCAGAGGAGGAAACTCGAGTTTCCTCCTCTGATCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-513s1c1
Sequence:CCGGCGTCCTGATGAAGTGGCCGATCTCGAGATCGGCCACTTCATCAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-396s1c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-438s1c1
Sequence:CCGGGTGAATAGGAAACCTGTGGTACTCGAGTACCACAGGTTTCCTATTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002012
VALIDATED
FHIT MISSION shRNA shRNA Plasmid DNA
fragile histidine triad
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-853s21c1
Sequence:GTACCGGGCTATTGCCAACCAGTTTGAACTCGAGTTCAAACTGGTTGGCAATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-433s21c1
Sequence:GTACCGGTGTCCTTCGCTCTTGTGAATACTCGAGTATTCACAAGAGCGAAGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-708s21c1
Sequence:GTACCGGATCTATGAGGAGCTCCAGAAACTCGAGTTTCTGGAGCTCCTCATAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-681s21c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-405s21c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-930s21c1
Sequence:CCGGTCATCTCACCATCCTGTATTCCTCGAGGAATACAGGATGGTGAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-591s21c1
Sequence:CCGGCATGGGACCTCTCTCACCTTTCTCGAGAAAGGTGAGAGAGGTCCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-652s21c1
Sequence:CCGGACGTTCACGTCCATGTTCTTCCTCGAGGAAGAACATGGACGTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-672s1c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-745s1c1
Sequence:CCGGCTTGGAGATCAGAGGAGGAAACTCGAGTTTCCTCCTCTGATCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-513s1c1
Sequence:CCGGCGTCCTGATGAAGTGGCCGATCTCGAGATCGGCCACTTCATCAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-396s1c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-438s1c1
Sequence:CCGGGTGAATAGGAAACCTGTGGTACTCGAGTACCACAGGTTTCCTATTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002012
VALIDATED
FHIT MISSION shRNA Lentiviral Transduction Particles
fragile histidine triad
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-853s21c1
Sequence:GTACCGGGCTATTGCCAACCAGTTTGAACTCGAGTTCAAACTGGTTGGCAATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-433s21c1
Sequence:GTACCGGTGTCCTTCGCTCTTGTGAATACTCGAGTATTCACAAGAGCGAAGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-708s21c1
Sequence:GTACCGGATCTATGAGGAGCTCCAGAAACTCGAGTTTCTGGAGCTCCTCATAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-681s21c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002012.2-405s21c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002012.2-930s21c1
Sequence:CCGGTCATCTCACCATCCTGTATTCCTCGAGGAATACAGGATGGTGAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-591s21c1
Sequence:CCGGCATGGGACCTCTCTCACCTTTCTCGAGAAAGGTGAGAGAGGTCCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002012.2-652s21c1
Sequence:CCGGACGTTCACGTCCATGTTCTTCCTCGAGGAAGAACATGGACGTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-672s1c1
Sequence:CCGGGCTGGAGACTTTCACAGGAATCTCGAGATTCCTGTGAAAGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-745s1c1
Sequence:CCGGCTTGGAGATCAGAGGAGGAAACTCGAGTTTCCTCCTCTGATCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002012.1-513s1c1
Sequence:CCGGCGTCCTGATGAAGTGGCCGATCTCGAGATCGGCCACTTCATCAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-396s1c1
Sequence:CCGGCCCTCTGTAGTGTTTCTCAAACTCGAGTTTGAGAAACACTACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002012.1-438s1c1
Sequence:CCGGGTGAATAGGAAACCTGTGGTACTCGAGTACCACAGGTTTCCTATTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)