EMAIL THIS PAGE TO A FRIEND

FHL1

four and a half LIM domains 1

Synonyms: FHL-1 FHL1A FHL1B FLH1A KYOT SLIM SLIM-1 SLIM1 SLIMMER XMPMA
Gene ID:
Human(2273) Summary: This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. Expression of these family members occurs in a cell- and tissue-specific mode and these proteins are involved in many cellular processes. Mutations in this gene have been found in patients with Emery-Dreifuss muscular dystrophy. Multiple alternately spliced transcript variants which encode different protein isoforms have been described.[provided by RefSeq, Nov 2009]
Mouse(14199) four and a half LIM domains 1
Rat(25177) four and a half LIM domains 1
chicken(770787) four and a half LIM domains 1
dog(492162) four and a half LIM domains 1
cow(509056) four and a half LIM domains 1
domestic cat(101098207) four and a half LIM domains 1
naked mole-rat(101702039) four and a half LIM domains 1
domestic guinea pig(100734222) four and a half LIM domains 1
sheep(100307044) four and a half LIM domains 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F0182 Anti-FHL1 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
F0307 Anti-FHL1 (113-125) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV34378 Anti-FHL1 antibody produced in rabbit IgG fraction of antiserum human, canine, pig, rat, guinea pig, mouse, horse, rabbit, sheep
immunohistochemistry, western blot pricing
HPA001040 Anti-FHL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA001391 Anti-FHL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry pricing
SAB2500397 Anti-FHL1/SLIM1 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, canine, human, rat, mouse, bovine
ELISA, immunohistochemistry, western blot pricing
SAB2500953 Anti-SLIMMER/FHL1 Isoform B antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
WH0002273M1 Monoclonal Anti-FHL1 antibody produced in mouse clone 2A9, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1403821 Monoclonal Anti-FHL1 antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB4100192 Monoclonal Anti-FHL1 antibody produced in mouse clone FHL1-A140, culture supernatant human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001449 Rosetta Predictions human pricing
NM_001033926 Rosetta Predictions rat pricing
NM_145669 Rosetta Predictions rat pricing
NM_001077361 Rosetta Predictions mouse pricing
NM_001077362 Rosetta Predictions mouse pricing
NM_010211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063566 predicted 527
2 SASI_Hs01_00063567 predicted 1095
3 SASI_Hs01_00063568 predicted 637
4 SASI_Hs01_00063569 predicted 929
5 SASI_Hs01_00063570 predicted 1077
6 SASI_Hs01_00063571 predicted 820
7 SASI_Hs01_00063572 predicted 762
8 SASI_Hs01_00063573 predicted 888
9 SASI_Hs01_00063574 predicted 519
10 SASI_Hs01_00063575 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040102 predicted 1263
2 SASI_Rn01_00040103 predicted 1377
3 SASI_Rn01_00040105 predicted 238
4 SASI_Rn01_00040106 predicted 1025
5 SASI_Rn02_00203828 predicted 1093
6 SASI_Rn02_00203829 predicted 1178
7 SASI_Rn01_00040107 predicted 1093
8 SASI_Rn01_00040108 predicted 1085
9 SASI_Rn01_00040109 predicted 1227
10 SASI_Rn01_00040110 predicted 334
11 SASI_Rn01_00040104 predicted 232
12 SASI_Rn01_00040111 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145669 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039902 predicted 1069
2 SASI_Rn01_00039904 predicted 237
3 SASI_Rn01_00039905 predicted 836
4 SASI_Rn01_00039906 predicted 900
5 SASI_Rn02_00268700 predicted 988
6 SASI_Rn01_00039907 predicted 915
7 SASI_Rn01_00039908 predicted 901
8 SASI_Rn01_00039909 predicted 1039
9 SASI_Rn02_00268701 predicted 227
10 SASI_Rn01_00039910 predicted 339
11 SASI_Rn01_00039903 predicted 231
12 SASI_Rn01_00039911 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292532 predicted 1635
2 SASI_Mm02_00292533 predicted 1589
3 SASI_Mm02_00292534 predicted 624
4 SASI_Mm02_00292535 predicted 539
5 SASI_Mm02_00292536 predicted 691
6 SASI_Mm02_00292537 predicted 1730
7 SASI_Mm02_00292538 predicted 1667
8 SASI_Mm02_00292539 predicted 1505
9 SASI_Mm02_00292540 predicted 1633
10 SASI_Mm02_00292541 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292542 predicted 908
2 SASI_Mm02_00292543 predicted 386
3 SASI_Mm02_00292544 predicted 528
4 SASI_Mm02_00292545 predicted 905
5 SASI_Mm02_00292546 predicted 1150
6 SASI_Mm02_00292547 predicted 1268
7 SASI_Mm02_00292548 predicted 848
8 SASI_Mm02_00292549 predicted 638
9 SASI_Mm02_00292550 predicted 746
10 SASI_Mm02_00292551 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318041 predicted 1443
2 SASI_Mm02_00318042 predicted 493
3 SASI_Mm01_00061508 predicted 562
4 SASI_Mm02_00318043 predicted 1394
5 SASI_Mm02_00318044 predicted 1333
6 SASI_Mm02_00318045 predicted 1165
7 SASI_Mm02_00318046 predicted 555
8 SASI_Mm02_00318047 predicted 1314
9 SASI_Mm02_00318048 predicted 528
10 SASI_Mm01_00061511 predicted 1299
11 SASI_Mm01_00061506 predicted 1081
12 SASI_Mm01_00061507 predicted 394
13 SASI_Mm01_00061509 predicted 909
14 SASI_Mm01_00061510 predicted 1150
15 SASI_Mm01_00061512 predicted 855
16 SASI_Mm01_00061513 predicted 1153
17 SASI_Mm01_00061514 predicted 644
18 SASI_Mm01_00061515 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001449
VALIDATED
FHL1 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-1927s1c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-835s1c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-672s1c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-918s1c1
Sequence:CCGGTGGTGGCCTATGAAGGACAATCTCGAGATTGTCCTTCATAGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001449.3-289s1c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-479s21c1
Sequence:CCGGCTCCAAGGAGGTGCACTATAACTCGAGTTATAGTGCACCTCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-956s21c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-410s21c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-2048s21c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-793s21c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001449
VALIDATED
FHL1 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-1927s1c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-835s1c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-672s1c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-918s1c1
Sequence:CCGGTGGTGGCCTATGAAGGACAATCTCGAGATTGTCCTTCATAGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001449.3-289s1c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-479s21c1
Sequence:CCGGCTCCAAGGAGGTGCACTATAACTCGAGTTATAGTGCACCTCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-956s21c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-410s21c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-2048s21c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-793s21c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001449
VALIDATED
FHL1 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-1927s1c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-835s1c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-672s1c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_001449.3-918s1c1
Sequence:CCGGTGGTGGCCTATGAAGGACAATCTCGAGATTGTCCTTCATAGGCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001449.3-289s1c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-479s21c1
Sequence:CCGGCTCCAAGGAGGTGCACTATAACTCGAGTTATAGTGCACCTCCTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-956s21c1
Sequence:CCGGCGTGGATTGCTACAAGAACTTCTCGAGAAGTTCTTGTAGCAATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-410s21c1
Sequence:CCGGCTGCCTGAAATGCTTTGACAACTCGAGTTGTCAAAGCATTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287067    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001449.4-2048s21c1
Sequence:CCGGGCAGTGCTGAAATTCATCCTACTCGAGTAGGATGAATTTCAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001449.4-793s21c1
Sequence:CCGGAGACCAAGTTTGCCAAGCATTCTCGAGAATGCTTGGCAAACTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010211
VALIDATED
FHL1 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-228s1c1
Sequence:CCGGCTTTGACAAGTTCTGCGCCAACTCGAGTTGGCGCAGAACTTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-523s1c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-216s1c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-595s1c1
Sequence:CCGGCATGAGACCAAGTTCGCCAAACTCGAGTTTGGCGAACTTGGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-1428s1c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010211.2-1458s21c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-246s21c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-553s21c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-315s21c1
Sequence:CCGGTGCCAAGGAGGTGCATTATAACTCGAGTTATAATGCACCTCCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-768s21c1
Sequence:CCGGCGCTGTGGAGGACCAGTATTACTCGAGTAATACTGGTCCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010211
VALIDATED
FHL1 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-228s1c1
Sequence:CCGGCTTTGACAAGTTCTGCGCCAACTCGAGTTGGCGCAGAACTTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-523s1c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-216s1c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-595s1c1
Sequence:CCGGCATGAGACCAAGTTCGCCAAACTCGAGTTTGGCGAACTTGGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-1428s1c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010211.2-1458s21c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-246s21c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-553s21c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-315s21c1
Sequence:CCGGTGCCAAGGAGGTGCATTATAACTCGAGTTATAATGCACCTCCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-768s21c1
Sequence:CCGGCGCTGTGGAGGACCAGTATTACTCGAGTAATACTGGTCCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010211
VALIDATED
FHL1 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-228s1c1
Sequence:CCGGCTTTGACAAGTTCTGCGCCAACTCGAGTTGGCGCAGAACTTGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-523s1c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010211.1-216s1c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-595s1c1
Sequence:CCGGCATGAGACCAAGTTCGCCAAACTCGAGTTTGGCGAACTTGGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113520    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010211.1-1428s1c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010211.2-1458s21c1
Sequence:CCGGGCAGTTAAGAACTTGCCAGAACTCGAGTTCTGGCAAGTTCTTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-246s21c1
Sequence:CCGGCTGCCTGAAGTGCTTTGACAACTCGAGTTGTCAAAGCACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-553s21c1
Sequence:CCGGAGCAACTGCAAGCAAGTCATTCTCGAGAATGACTTGCTTGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-315s21c1
Sequence:CCGGTGCCAAGGAGGTGCATTATAACTCGAGTTATAATGCACCTCCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010211.2-768s21c1
Sequence:CCGGCGCTGTGGAGGACCAGTATTACTCGAGTAATACTGGTCCTCCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks