EMAIL THIS PAGE TO A FRIEND

FHL2

four and a half LIM domains 2

Synonyms: AAG11 DRAL FHL-2 SLIM-3 SLIM3
UniProtKB ID: Q14192, Q13229, Q13644, Q2I5I4, Q9P294
Gene ID:
Human(2274) Summary: This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011]
Mouse(14200) four and a half LIM domains 2
Rat(63839) four and a half LIM domains 2
chicken(418726) four and a half LIM domains 2
dog(474544) four and a half LIM domains 2
cow(510008) four and a half LIM domains 2
domestic cat(101100121) four and a half LIM domains 2
sheep(101122510) four and a half LIM domains 2
domestic guinea pig(100732487) four and a half LIM domains 2
naked mole-rat(101719115) four and a half LIM domains 2
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001450 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039492 Rosetta Predictions human pricing
NM_001450 Rosetta Predictions human pricing
NM_201555 Rosetta Predictions human pricing
NM_201557 Rosetta Predictions human pricing
NM_031677 Rosetta Predictions rat pricing
NM_010212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094751 predicted 1065
2 SASI_Hs01_00094752 predicted 1096
3 SASI_Hs02_00308534 predicted 1118
4 SASI_Hs02_00308535 predicted 368
5 SASI_Hs01_00094753 predicted 1129
6 SASI_Hs01_00094754 predicted 1124
7 SASI_Hs01_00094755 predicted 1142
8 SASI_Hs01_00094757 predicted 559
9 SASI_Hs01_00094758 predicted 1062
10 SASI_Hs02_00308536 predicted 771
11 SASI_Hs01_00094756 predicted 894
12 SASI_Hs01_00094759 predicted 424
13 SASI_Hs01_00094760 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014060 predicted 1311
2 SASI_Hs01_00014061 predicted 1340
3 SASI_Hs02_00331876 predicted 1369
4 SASI_Hs02_00331877 predicted 621
5 SASI_Hs01_00014062 predicted 1373
6 SASI_Hs01_00014063 predicted 1370
7 SASI_Hs01_00014064 predicted 1387
8 SASI_Hs01_00014066 predicted 804
9 SASI_Hs01_00014067 predicted 1312
10 SASI_Hs02_00331878 predicted 1011
11 SASI_Hs01_00014065 predicted 1135
12 SASI_Hs01_00014068 predicted 674
13 SASI_Hs01_00014069 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169503 predicted 1478
2 SASI_Hs01_00169504 predicted 1511
3 SASI_Hs02_00373045 predicted 1539
4 SASI_Hs02_00373046 predicted 790
5 SASI_Hs01_00169505 predicted 1549
6 SASI_Hs01_00169506 predicted 1541
7 SASI_Hs01_00169507 predicted 1559
8 SASI_Hs01_00169509 predicted 975
9 SASI_Hs01_00169510 predicted 1485
10 SASI_Hs02_00373047 predicted 1182
11 SASI_Hs01_00169508 predicted 1313
12 SASI_Hs01_00169511 predicted 840
13 SASI_Hs01_00169512 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090985 predicted 1035
2 SASI_Hs01_00090986 predicted 1063
3 SASI_Hs02_00373048 predicted 1092
4 SASI_Hs02_00373049 predicted 336
5 SASI_Hs01_00090987 predicted 1102
6 SASI_Hs01_00090988 predicted 1091
7 SASI_Hs01_00090989 predicted 1110
8 SASI_Hs01_00090991 predicted 529
9 SASI_Hs01_00090992 predicted 1029
10 SASI_Hs02_00373050 predicted 741
11 SASI_Hs01_00090990 predicted 860
12 SASI_Hs01_00090993 predicted 392
13 SASI_Hs01_00090994 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078909 predicted 498
2 SASI_Rn01_00078910 predicted 500
3 SASI_Rn02_00265021 predicted 411
4 SASI_Rn01_00078911 predicted 573
5 SASI_Rn01_00078913 predicted 446
6 SASI_Rn01_00078915 predicted 470
7 SASI_Rn01_00078916 predicted 405
8 SASI_Rn01_00078917 predicted 615
9 SASI_Rn02_00265022 predicted 403
10 SASI_Rn01_00078918 predicted 602
11 SASI_Rn01_00078912 predicted 297
12 SASI_Rn01_00078914 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181197 predicted 351
2 SASI_Mm02_00318049 predicted 987
3 SASI_Mm02_00318050 predicted 1008
4 SASI_Mm02_00318051 predicted 1080
5 SASI_Mm02_00318052 predicted 1243
6 SASI_Mm01_00181198 predicted 492
7 SASI_Mm02_00318053 predicted 977
8 SASI_Mm01_00181202 predicted 364
9 SASI_Mm01_00181204 predicted 731
10 SASI_Mm02_00318054 predicted 1096
11 SASI_Mm01_00181199 predicted 582
12 SASI_Mm01_00181200 predicted 771
13 SASI_Mm01_00181201 predicted 589
14 SASI_Mm01_00181203 predicted 809
15 SASI_Mm01_00181205 predicted 439
16 SASI_Mm01_00181206 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010212
VALIDATED
FHL2 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-922s21c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010212.3-1309s21c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-378s21c1
Sequence:CCGGTTGAGGAACTCTATGCCAATACTCGAGTATTGGCATAGAGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-787s21c1
Sequence:CCGGTATCACCACAGGAGGTGTTACCTCGAGGTAACACCTCCTGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-1013s21c1
Sequence:CCGGTGGCACAACGACTGCTTTAACCTCGAGGTTAAAGCAGTCGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-1199s1c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-812s1c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-962s1c1
Sequence:CCGGCCTCACAGAGAGAGATGACATCTCGAGATGTCATCTCTCTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010212.1-443s1c1
Sequence:CCGGCGACTGCTATTCCAATGAATACTCGAGTATTCATTGGAATAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-218s1c1
Sequence:CCGGCGGCAAGAAGTACATTCTAAACTCGAGTTTAGAATGTACTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010212
VALIDATED
FHL2 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-922s21c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010212.3-1309s21c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-378s21c1
Sequence:CCGGTTGAGGAACTCTATGCCAATACTCGAGTATTGGCATAGAGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-787s21c1
Sequence:CCGGTATCACCACAGGAGGTGTTACCTCGAGGTAACACCTCCTGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-1013s21c1
Sequence:CCGGTGGCACAACGACTGCTTTAACCTCGAGGTTAAAGCAGTCGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-1199s1c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-812s1c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-962s1c1
Sequence:CCGGCCTCACAGAGAGAGATGACATCTCGAGATGTCATCTCTCTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010212.1-443s1c1
Sequence:CCGGCGACTGCTATTCCAATGAATACTCGAGTATTCATTGGAATAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-218s1c1
Sequence:CCGGCGGCAAGAAGTACATTCTAAACTCGAGTTTAGAATGTACTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010212
VALIDATED
FHL2 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-922s21c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010212.3-1309s21c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-378s21c1
Sequence:CCGGTTGAGGAACTCTATGCCAATACTCGAGTATTGGCATAGAGTTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010212.3-787s21c1
Sequence:CCGGTATCACCACAGGAGGTGTTACCTCGAGGTAACACCTCCTGTGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010212.3-1013s21c1
Sequence:CCGGTGGCACAACGACTGCTTTAACCTCGAGGTTAAAGCAGTCGTTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113500    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-1199s1c1
Sequence:CCGGGATGGGAAGATGGTTTGGAATCTCGAGATTCCAAACCATCTTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-812s1c1
Sequence:CCGGCTGTGACTTGTACGCTAAGAACTCGAGTTCTTAGCGTACAAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-962s1c1
Sequence:CCGGCCTCACAGAGAGAGATGACATCTCGAGATGTCATCTCTCTCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010212.1-443s1c1
Sequence:CCGGCGACTGCTATTCCAATGAATACTCGAGTATTCATTGGAATAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010212.1-218s1c1
Sequence:CCGGCGGCAAGAAGTACATTCTAAACTCGAGTTTAGAATGTACTTCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001450
VALIDATED
FHL2 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-1349s21c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001450.3-1145s21c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-440s21c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-834s21c1
Sequence:CCGGCCCAAAGACAATCAGAATTTCCTCGAGGAAATTCTGATTGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-810s21c1
Sequence:CCGGCCAATTGGAACCAAGAGTTTCCTCGAGGAAACTCTTGGTTCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1349s1c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-440s1c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001450.3-710s1c1
Sequence:CCGGCCAGGAATGCAAGAAGACCATCTCGAGATGGTCTTCTTGCATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1145s1c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-861s1c1
Sequence:CCGGCCCTGCTATGAGAAACAACATCTCGAGATGTTGTTTCTCATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001450
VALIDATED
FHL2 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-1349s21c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001450.3-1145s21c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-440s21c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-834s21c1
Sequence:CCGGCCCAAAGACAATCAGAATTTCCTCGAGGAAATTCTGATTGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-810s21c1
Sequence:CCGGCCAATTGGAACCAAGAGTTTCCTCGAGGAAACTCTTGGTTCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1349s1c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-440s1c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001450.3-710s1c1
Sequence:CCGGCCAGGAATGCAAGAAGACCATCTCGAGATGGTCTTCTTGCATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1145s1c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-861s1c1
Sequence:CCGGCCCTGCTATGAGAAACAACATCTCGAGATGTTGTTTCTCATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001450
VALIDATED
FHL2 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273529    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-1349s21c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001450.3-1145s21c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-440s21c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-834s21c1
Sequence:CCGGCCCAAAGACAATCAGAATTTCCTCGAGGAAATTCTGATTGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001450.3-810s21c1
Sequence:CCGGCCAATTGGAACCAAGAGTTTCCTCGAGGAAACTCTTGGTTCCAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1349s1c1
Sequence:CCGGGAGACTTTCTTCTAGTGCTTTCTCGAGAAAGCACTAGAAGAAAGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-440s1c1
Sequence:CCGGCGAATCTCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGAGATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001450.3-710s1c1
Sequence:CCGGCCAGGAATGCAAGAAGACCATCTCGAGATGGTCTTCTTGCATTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-1145s1c1
Sequence:CCGGCGACTGCTTTAACTGTAAGAACTCGAGTTCTTACAGTTAAAGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001450.3-861s1c1
Sequence:CCGGCCCTGCTATGAGAAACAACATCTCGAGATGTTGTTTCTCATAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks