EMAIL THIS PAGE TO A FRIEND

FHL3

four and a half LIM domains 3

58 Gene Product Result for
Synonyms: SLIM2
UniProtKB ID: Q13643, D3DPT6, Q6I9T0, Q9BVA2
Gene ID:
Human(2275) Summary: The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(14201) four and a half LIM domains 3
Rat(313582) four and a half LIM domains 3
chicken(419607) four and a half LIM domains 3
dog(608080) four and a half LIM domains 3
cow(504795) four and a half LIM domains 3
domestic cat(101093198) four and a half LIM domains 3
naked mole-rat(101705914) four and a half LIM domains 3
domestic guinea pig(100714809) four and a half LIM domains 3
sheep(101117026) four and a half LIM domains 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154641 MISSION® esiRNA esiRNA human FHL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004468 Rosetta Predictions human pricing
NM_001107979 Rosetta Predictions rat pricing
NM_010213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162578 predicted 646
2 SASI_Hs01_00162580 predicted 470
3 SASI_Hs01_00162581 predicted 724
4 SASI_Hs02_00337675 predicted 1451
5 SASI_Hs01_00162583 predicted 498
6 SASI_Hs01_00162584 predicted 922
7 SASI_Hs01_00162585 predicted 761
8 SASI_Hs02_00337676 predicted 1419
9 SASI_Hs02_00337677 predicted 676
10 SASI_Hs02_00337678 predicted 865
11 SASI_Hs01_00162577 predicted 831
12 SASI_Hs01_00162579 predicted 850
13 SASI_Hs01_00162582 predicted 682
14 SASI_Hs01_00162586 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234165 predicted 786
2 SASI_Rn02_00234166 predicted 317
3 SASI_Rn02_00234167 predicted 487
4 SASI_Rn02_00234168 predicted 697
5 SASI_Rn02_00234169 predicted 214
6 SASI_Rn02_00234170 predicted 733
7 SASI_Rn02_00234171 predicted 512
8 SASI_Rn02_00234172 predicted 683
9 SASI_Rn02_00234173 predicted 295
10 SASI_Rn02_00234174 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318055 predicted 1148
2 SASI_Mm02_00318056 predicted 795
3 SASI_Mm01_00141082 predicted 203
4 SASI_Mm02_00318057 predicted 590
5 SASI_Mm02_00318058 predicted 1040
6 SASI_Mm02_00318059 predicted 754
7 SASI_Mm02_00318060 predicted 606
8 SASI_Mm02_00318061 predicted 756
9 SASI_Mm02_00318062 predicted 262
10 SASI_Mm02_00318063 predicted 519
11 SASI_Mm01_00141080 predicted 732
12 SASI_Mm01_00141081 predicted 603
13 SASI_Mm01_00141083 predicted 209
14 SASI_Mm01_00141084 predicted 689
15 SASI_Mm01_00141085 predicted 625
16 SASI_Mm01_00141086 predicted 440
17 SASI_Mm01_00141087 predicted 425
18 SASI_Mm01_00141088 predicted 532
19 SASI_Mm01_00141089 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004468
VALIDATED
FHL3 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004468.3-770s1c1
Sequence:CCGGCATCGAGAATGTCTGGTCTGTCTCGAGACAGACCAGACATTCTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-276s1c1
Sequence:CCGGGCAAGTACATCCAGACAGACACTCGAGTGTCTGTCTGGATGTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-318s1c1
Sequence:CCGGGCTATGACAATACCTTTGCCACTCGAGTGGCAAAGGTATTGTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004468.3-928s1c1
Sequence:CCGGCAAGTATGTGTCCTTTGAAGACTCGAGTCTTCAAAGGACACATACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-1409s1c1
Sequence:CCGGCCCTTAAATCTAGACTTCTCTCTCGAGAGAGAAGTCTAGATTTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004468.3-867s1c1
Sequence:CCGGGAGAACTCTTTGCACCTAAGTCTCGAGACTTAGGTGCAAAGAGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-447s21c1
Sequence:CCGGCACTAGCCGATGAACCCTTCACTCGAGTGAAGGGTTCATCGGCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004468.3-1245s21c1
Sequence:CCGGCAATCCTGGGCTCTTACAGAGCTCGAGCTCTGTAAGAGCCCAGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-570s21c1
Sequence:CCGGTGGAATATGGAGGCCAGACATCTCGAGATGTCTGGCCTCCATATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-916s21c1
Sequence:CCGGACTCGGTGGAGGCAAGTATGTCTCGAGACATACTTGCCTCCACCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-377s21c1
Sequence:CCGGTCGAGGGAGCTGTTCTATGAACTCGAGTTCATAGAACAGCTCCCTCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-742s21c1
Sequence:CCGGTGGAGTGACATACCGTGATCACTCGAGTGATCACGGTATGTCACTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004468
VALIDATED
FHL3 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004468.3-770s1c1
Sequence:CCGGCATCGAGAATGTCTGGTCTGTCTCGAGACAGACCAGACATTCTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-276s1c1
Sequence:CCGGGCAAGTACATCCAGACAGACACTCGAGTGTCTGTCTGGATGTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-318s1c1
Sequence:CCGGGCTATGACAATACCTTTGCCACTCGAGTGGCAAAGGTATTGTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004468.3-928s1c1
Sequence:CCGGCAAGTATGTGTCCTTTGAAGACTCGAGTCTTCAAAGGACACATACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-1409s1c1
Sequence:CCGGCCCTTAAATCTAGACTTCTCTCTCGAGAGAGAAGTCTAGATTTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004468.3-867s1c1
Sequence:CCGGGAGAACTCTTTGCACCTAAGTCTCGAGACTTAGGTGCAAAGAGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-447s21c1
Sequence:CCGGCACTAGCCGATGAACCCTTCACTCGAGTGAAGGGTTCATCGGCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004468.3-1245s21c1
Sequence:CCGGCAATCCTGGGCTCTTACAGAGCTCGAGCTCTGTAAGAGCCCAGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-570s21c1
Sequence:CCGGTGGAATATGGAGGCCAGACATCTCGAGATGTCTGGCCTCCATATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-916s21c1
Sequence:CCGGACTCGGTGGAGGCAAGTATGTCTCGAGACATACTTGCCTCCACCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-377s21c1
Sequence:CCGGTCGAGGGAGCTGTTCTATGAACTCGAGTTCATAGAACAGCTCCCTCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-742s21c1
Sequence:CCGGTGGAGTGACATACCGTGATCACTCGAGTGATCACGGTATGTCACTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004468
VALIDATED
FHL3 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004468.3-770s1c1
Sequence:CCGGCATCGAGAATGTCTGGTCTGTCTCGAGACAGACCAGACATTCTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-276s1c1
Sequence:CCGGGCAAGTACATCCAGACAGACACTCGAGTGTCTGTCTGGATGTACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-318s1c1
Sequence:CCGGGCTATGACAATACCTTTGCCACTCGAGTGGCAAAGGTATTGTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004468.3-928s1c1
Sequence:CCGGCAAGTATGTGTCCTTTGAAGACTCGAGTCTTCAAAGGACACATACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004468.3-1409s1c1
Sequence:CCGGCCCTTAAATCTAGACTTCTCTCTCGAGAGAGAAGTCTAGATTTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004468.3-867s1c1
Sequence:CCGGGAGAACTCTTTGCACCTAAGTCTCGAGACTTAGGTGCAAAGAGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-447s21c1
Sequence:CCGGCACTAGCCGATGAACCCTTCACTCGAGTGAAGGGTTCATCGGCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004468.3-1245s21c1
Sequence:CCGGCAATCCTGGGCTCTTACAGAGCTCGAGCTCTGTAAGAGCCCAGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-570s21c1
Sequence:CCGGTGGAATATGGAGGCCAGACATCTCGAGATGTCTGGCCTCCATATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-916s21c1
Sequence:CCGGACTCGGTGGAGGCAAGTATGTCTCGAGACATACTTGCCTCCACCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-377s21c1
Sequence:CCGGTCGAGGGAGCTGTTCTATGAACTCGAGTTCATAGAACAGCTCCCTCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004468.3-742s21c1
Sequence:CCGGTGGAGTGACATACCGTGATCACTCGAGTGATCACGGTATGTCACTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010213
VALIDATED
FHL3 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-625s1c1
Sequence:CCGGCCCTGCTATGAGAACAAGTTTCTCGAGAAACTTGTTCTCATAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-331s1c1
Sequence:CCGGCTGTTCTATGAAGACCGCCATCTCGAGATGGCGGTCTTCATAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-264s1c1
Sequence:CCGGCTATGACAACACCTTCGCCAACTCGAGTTGGCGAAGGTGTTGTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-219s1c1
Sequence:CCGGCCGCAAATACATCCAGACAGACTCGAGTCTGTCTGGATGTATTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-333s1c1
Sequence:CCGGGTTCTATGAAGACCGCCATTTCTCGAGAAATGGCGGTCTTCATAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-615s21c1
Sequence:GTACCGGTGCCTTGCTATGAGAACAAATCTCGAGATTTGTTCTCATAGCAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-1360s21c1
Sequence:CCGGCAAGACTTCTAGGGTAGATTTCTCGAGAAATCTACCCTAGAAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-985s21c1
Sequence:CCGGAGACGGAGATCAAGTTCTATGCTCGAGCATAGAACTTGATCTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-901s21c1
Sequence:CCGGGTCCTTCGAAGACCGACATTGCTCGAGCAATGTCGGTCTTCGAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-795s21c1
Sequence:CCGGCCTGCTTTGGAGAACTCTTTGCTCGAGCAAAGAGTTCTCCAAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010213
VALIDATED
FHL3 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-625s1c1
Sequence:CCGGCCCTGCTATGAGAACAAGTTTCTCGAGAAACTTGTTCTCATAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-331s1c1
Sequence:CCGGCTGTTCTATGAAGACCGCCATCTCGAGATGGCGGTCTTCATAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-264s1c1
Sequence:CCGGCTATGACAACACCTTCGCCAACTCGAGTTGGCGAAGGTGTTGTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-219s1c1
Sequence:CCGGCCGCAAATACATCCAGACAGACTCGAGTCTGTCTGGATGTATTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-333s1c1
Sequence:CCGGGTTCTATGAAGACCGCCATTTCTCGAGAAATGGCGGTCTTCATAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-615s21c1
Sequence:GTACCGGTGCCTTGCTATGAGAACAAATCTCGAGATTTGTTCTCATAGCAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-1360s21c1
Sequence:CCGGCAAGACTTCTAGGGTAGATTTCTCGAGAAATCTACCCTAGAAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-985s21c1
Sequence:CCGGAGACGGAGATCAAGTTCTATGCTCGAGCATAGAACTTGATCTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-901s21c1
Sequence:CCGGGTCCTTCGAAGACCGACATTGCTCGAGCAATGTCGGTCTTCGAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-795s21c1
Sequence:CCGGCCTGCTTTGGAGAACTCTTTGCTCGAGCAAAGAGTTCTCCAAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010213
VALIDATED
FHL3 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-625s1c1
Sequence:CCGGCCCTGCTATGAGAACAAGTTTCTCGAGAAACTTGTTCTCATAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-331s1c1
Sequence:CCGGCTGTTCTATGAAGACCGCCATCTCGAGATGGCGGTCTTCATAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-264s1c1
Sequence:CCGGCTATGACAACACCTTCGCCAACTCGAGTTGGCGAAGGTGTTGTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-219s1c1
Sequence:CCGGCCGCAAATACATCCAGACAGACTCGAGTCTGTCTGGATGTATTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010213.1-333s1c1
Sequence:CCGGGTTCTATGAAGACCGCCATTTCTCGAGAAATGGCGGTCTTCATAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-615s21c1
Sequence:GTACCGGTGCCTTGCTATGAGAACAAATCTCGAGATTTGTTCTCATAGCAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-1360s21c1
Sequence:CCGGCAAGACTTCTAGGGTAGATTTCTCGAGAAATCTACCCTAGAAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-985s21c1
Sequence:CCGGAGACGGAGATCAAGTTCTATGCTCGAGCATAGAACTTGATCTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-901s21c1
Sequence:CCGGGTCCTTCGAAGACCGACATTGCTCGAGCAATGTCGGTCTTCGAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010213.2-795s21c1
Sequence:CCGGCCTGCTTTGGAGAACTCTTTGCTCGAGCAAAGAGTTCTCCAAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)