EMAIL THIS PAGE TO A FRIEND

FHL5

four and a half LIM domains 5

79 Gene Product Result for
Synonyms: ACT RP3-393D12.2 dJ393D12.2
UniProtKB ID: Q5TD97, B2RBD1, E1P526, Q5TD98, Q8WW21, Q9NQU2
Gene ID:
Human(9457) Summary: The protein encoded by this gene is coordinately expressed with activator of cAMP-responsive element modulator (CREM). It is associated with CREM and confers a powerful transcriptional activation function. CREM acts as a transcription factor essential for the differentiation of spermatids into mature spermatozoa. There are multiple polyadenylation sites found in this gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Dec 2009]
Mouse(57756) four and a half LIM domains 5
Rat(297954) four and a half LIM domains 5
domestic guinea pig(100719770) four and a half LIM domains 5
naked mole-rat(101721565) four and a half LIM domains 5
sheep(101106018) four and a half LIM domains 5
chicken(421803) four and a half LIM domains 5
dog(475000) four and a half LIM domains 5
cow(615499) four and a half LIM domains 5
domestic cat(101080890) four and a half LIM domains 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030831 MISSION® esiRNA esiRNA human FHL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020482 Rosetta Predictions human pricing
NM_001013088 Rosetta Predictions rat pricing
NM_021318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133354 predicted 1360
2 SASI_Hs01_00133355 predicted 617
3 SASI_Hs01_00133357 predicted 542
4 SASI_Hs01_00133359 predicted 903
5 SASI_Hs01_00133360 predicted 541
6 SASI_Hs01_00133361 predicted 551
7 SASI_Hs01_00133362 predicted 957
8 SASI_Hs01_00133363 predicted 477
9 SASI_Hs02_00353564 predicted 791
10 SASI_Hs02_00353565 predicted 474
11 SASI_Hs01_00133356 predicted 1064
12 SASI_Hs01_00133358 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075370 predicted 666
2 SASI_Rn01_00075371 predicted 623
3 SASI_Rn01_00075373 predicted 897
4 SASI_Rn01_00075374 predicted 782
5 SASI_Rn01_00075375 predicted 460
6 SASI_Rn01_00075376 predicted 792
7 SASI_Rn01_00075377 predicted 192
8 SASI_Rn01_00075379 predicted 401
9 SASI_Rn02_00200729 predicted 203
10 SASI_Rn02_00200730 predicted 833
11 SASI_Rn01_00075372 predicted 561
12 SASI_Rn01_00075378 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083045 predicted 653
2 SASI_Mm01_00083046 predicted 319
3 SASI_Mm01_00083047 predicted 326
4 SASI_Mm01_00083048 predicted 813
5 SASI_Mm01_00083049 predicted 712
6 SASI_Mm01_00083051 predicted 768
7 SASI_Mm01_00083052 predicted 603
8 SASI_Mm01_00083053 predicted 679
9 SASI_Mm02_00325871 predicted 795
10 SASI_Mm02_00325872 predicted 393
11 SASI_Mm01_00083050 predicted 888
12 SASI_Mm01_00083054 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021318
FHL5 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-624s1c1
Sequence:CCGGGCAATTATTGTGTGCCATGTTCTCGAGAACATGGCACACAATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-884s1c1
Sequence:CCGGGCCAAGTTCATCTGCTTTCAACTCGAGTTGAAAGCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-621s1c1
Sequence:CCGGGTGGCAATTATTGTGTGCCATCTCGAGATGGCACACAATAATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-978s1c1
Sequence:CCGGCCCATAACATGGAAATCTTATCTCGAGATAAGATTTCCATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-305s1c1
Sequence:CCGGGAGCAGTGTAAAGAACCAATTCTCGAGAATTGGTTCTTTACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021318
FHL5 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-624s1c1
Sequence:CCGGGCAATTATTGTGTGCCATGTTCTCGAGAACATGGCACACAATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-884s1c1
Sequence:CCGGGCCAAGTTCATCTGCTTTCAACTCGAGTTGAAAGCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-621s1c1
Sequence:CCGGGTGGCAATTATTGTGTGCCATCTCGAGATGGCACACAATAATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-978s1c1
Sequence:CCGGCCCATAACATGGAAATCTTATCTCGAGATAAGATTTCCATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-305s1c1
Sequence:CCGGGAGCAGTGTAAAGAACCAATTCTCGAGAATTGGTTCTTTACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021318
FHL5 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-624s1c1
Sequence:CCGGGCAATTATTGTGTGCCATGTTCTCGAGAACATGGCACACAATAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-884s1c1
Sequence:CCGGGCCAAGTTCATCTGCTTTCAACTCGAGTTGAAAGCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-621s1c1
Sequence:CCGGGTGGCAATTATTGTGTGCCATCTCGAGATGGCACACAATAATTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-978s1c1
Sequence:CCGGCCCATAACATGGAAATCTTATCTCGAGATAAGATTTCCATGTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021318.2-305s1c1
Sequence:CCGGGAGCAGTGTAAAGAACCAATTCTCGAGAATTGGTTCTTTACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020482
FHL5 MISSION shRNA Bacterial Glycerol Stock
four and a half LIM domains 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-945s1c1
Sequence:CCGGGCTATGGCATAAAGAGTGTTTCTCGAGAAACACTCTTTATGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-482s1c1
Sequence:CCGGGTCCATACTGTGTTACATGTTCTCGAGAACATGTAACACAGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-1054s1c1
Sequence:CCGGCTTTATGCCAACAAGTGTGTACTCGAGTACACACTTGTTGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020482.3-1618s1c1
Sequence:CCGGGAGATCAAACTGAGAGGTATACTCGAGTATACCTCTCAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1326s21c1
Sequence:CCGGGAACTCAGTTGCGGTCTTATTCTCGAGAATAAGACCGCAACTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1018s21c1
Sequence:CCGGTCATGTCCAGAGACGACTATCCTCGAGGATAGTCGTCTCTGGACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-807s21c1
Sequence:CCGGGAGAATTGCCGACAACCTATACTCGAGTATAGGTTGTCGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1160s21c1
Sequence:CCGGATGCTTTAACTGCGGGAAATGCTCGAGCATTTCCCGCAGTTAAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1301s21c1
Sequence:CCGGTTTGCCTTCGTTGTCACTAAACTCGAGTTTAGTGACAACGAAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-563s21c1
Sequence:CCGGATCTGATTCTAAGGATCTTTGCTCGAGCAAAGATCCTTAGAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-610s21c1
Sequence:CCGGGATGCTTCAAGTGCACCAAATCTCGAGATTTGGTGCACTTGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020482
FHL5 MISSION shRNA shRNA Plasmid DNA
four and a half LIM domains 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-945s1c1
Sequence:CCGGGCTATGGCATAAAGAGTGTTTCTCGAGAAACACTCTTTATGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-482s1c1
Sequence:CCGGGTCCATACTGTGTTACATGTTCTCGAGAACATGTAACACAGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-1054s1c1
Sequence:CCGGCTTTATGCCAACAAGTGTGTACTCGAGTACACACTTGTTGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020482.3-1618s1c1
Sequence:CCGGGAGATCAAACTGAGAGGTATACTCGAGTATACCTCTCAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1326s21c1
Sequence:CCGGGAACTCAGTTGCGGTCTTATTCTCGAGAATAAGACCGCAACTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1018s21c1
Sequence:CCGGTCATGTCCAGAGACGACTATCCTCGAGGATAGTCGTCTCTGGACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-807s21c1
Sequence:CCGGGAGAATTGCCGACAACCTATACTCGAGTATAGGTTGTCGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1160s21c1
Sequence:CCGGATGCTTTAACTGCGGGAAATGCTCGAGCATTTCCCGCAGTTAAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1301s21c1
Sequence:CCGGTTTGCCTTCGTTGTCACTAAACTCGAGTTTAGTGACAACGAAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-563s21c1
Sequence:CCGGATCTGATTCTAAGGATCTTTGCTCGAGCAAAGATCCTTAGAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-610s21c1
Sequence:CCGGGATGCTTCAAGTGCACCAAATCTCGAGATTTGGTGCACTTGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020482
FHL5 MISSION shRNA Lentiviral Transduction Particles
four and a half LIM domains 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-945s1c1
Sequence:CCGGGCTATGGCATAAAGAGTGTTTCTCGAGAAACACTCTTTATGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-482s1c1
Sequence:CCGGGTCCATACTGTGTTACATGTTCTCGAGAACATGTAACACAGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020482.3-1054s1c1
Sequence:CCGGCTTTATGCCAACAAGTGTGTACTCGAGTACACACTTGTTGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020482.3-1618s1c1
Sequence:CCGGGAGATCAAACTGAGAGGTATACTCGAGTATACCTCTCAGTTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1326s21c1
Sequence:CCGGGAACTCAGTTGCGGTCTTATTCTCGAGAATAAGACCGCAACTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1018s21c1
Sequence:CCGGTCATGTCCAGAGACGACTATCCTCGAGGATAGTCGTCTCTGGACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-807s21c1
Sequence:CCGGGAGAATTGCCGACAACCTATACTCGAGTATAGGTTGTCGGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-1160s21c1
Sequence:CCGGATGCTTTAACTGCGGGAAATGCTCGAGCATTTCCCGCAGTTAAAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020482.4-1301s21c1
Sequence:CCGGTTTGCCTTCGTTGTCACTAAACTCGAGTTTAGTGACAACGAAGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-563s21c1
Sequence:CCGGATCTGATTCTAAGGATCTTTGCTCGAGCAAAGATCCTTAGAATCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020482.4-610s21c1
Sequence:CCGGGATGCTTCAAGTGCACCAAATCTCGAGATTTGGTGCACTTGAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks