EMAIL THIS PAGE TO A FRIEND

FHOD3

formin homology 2 domain containing 3

38 Gene Product Result for
Synonyms: FHOS2 Formactin2
Gene ID:
Human(80206) Summary: Proteins that contain formin (FMN1; MIM 136535) homology (FH) domains, such as FHOD3, play a role in regulation of the actin cytoskeleton (Kanaya et al., 2005 [PubMed 15966898]
Mouse(225288) formin homology 2 domain containing 3
Rat(100360334) formin homology 2 domain containing 3
domestic guinea pig(100732768) formin homology 2 domain containing 3
naked mole-rat(101715266) formin homology 2 domain containing 3
sheep(101115334) formin homology 2 domain containing 3
Domestic Rabbit(100352923) formin homology 2 domain containing 3
chicken(420952) formin homology 2 domain containing 3
dog(480157) formin homology 2 domain containing 3
cow(785433) formin homology 2 domain containing 3
Horse(100067548) formin homology 2 domain containing 3
domestic cat(101098341) formin homology 2 domain containing 3
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025135 Rosetta Predictions human pricing
NM_175276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094418 predicted 3039
2 SASI_Hs01_00094420 predicted 566
3 SASI_Hs01_00094422 predicted 2910
4 SASI_Hs01_00094425 predicted 3014
5 SASI_Hs01_00094426 predicted 3361
6 SASI_Hs01_00094427 predicted 3604
7 SASI_Hs02_00357850 predicted 489
8 SASI_Hs02_00357851 predicted 3842
9 SASI_Hs02_00357852 predicted 3156
10 SASI_Hs02_00357853 predicted 4498
11 SASI_Hs01_00094419 predicted 3402
12 SASI_Hs01_00094421 predicted 3782
13 SASI_Hs01_00094423 predicted 637
14 SASI_Hs01_00094424 predicted 3130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077974 predicted 576
2 SASI_Mm01_00077975 predicted 993
3 SASI_Mm02_00346002 predicted 698
4 SASI_Mm01_00077976 predicted 889
5 SASI_Mm01_00077977 predicted 3499
6 SASI_Mm01_00077978 predicted 3393
7 SASI_Mm01_00077980 predicted 4092
8 SASI_Mm01_00077981 predicted 437
9 SASI_Mm01_00077982 predicted 3562
10 SASI_Mm01_00077983 predicted 1388
11 SASI_Mm01_00077979 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025135
FHOD3 MISSION shRNA Bacterial Glycerol Stock
formin homology 2 domain containing 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2485s1c1
Sequence:CCGGGCCGAAGACAGAGTCTGATTACTCGAGTAATCAGACTCTGTCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-3836s1c1
Sequence:CCGGCCACCTTATGCAATTCGGGAACTCGAGTTCCCGAATTGCATAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4456s1c1
Sequence:CCGGGCAAGCTCTTGCTGGATGAAACTCGAGTTTCATCCAGCAAGAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-2170s1c1
Sequence:CCGGCAAACGGTTCATGCTTGACATCTCGAGATGTCAAGCATGAACCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1530s1c1
Sequence:CCGGGAAACAAATTCAGCCGAGATTCTCGAGAATCTCGGCTGAATTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2950s1c1
Sequence:CCGGCCTGTTTGAGTCTAAATCCAACTCGAGTTGGATTTAGACTCAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025135.2-4656s1c1
Sequence:CCGGCACCCGGTTTATTAGTTCAAACTCGAGTTTGAACTAATAAACCGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4720s1c1
Sequence:CCGGCAAATCACTTCTGTCACAGTTCTCGAGAACTGTGACAGAAGTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1031s1c1
Sequence:CCGGGTGGAGCAACTCAACATTTATCTCGAGATAAATGTTGAGTTGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4719s1c1
Sequence:CCGGGCAAATCACTTCTGTCACAGTCTCGAGACTGTGACAGAAGTGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-3608s1c1
Sequence:CCGGGCCAAGGTTGACTTTGATCAACTCGAGTTGATCAAAGTCAACCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2161s1c1
Sequence:CCGGCCTCACCAACAAACGGTTCATCTCGAGATGAACCGTTTGTTGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025135
FHOD3 MISSION shRNA shRNA Plasmid DNA
formin homology 2 domain containing 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2485s1c1
Sequence:CCGGGCCGAAGACAGAGTCTGATTACTCGAGTAATCAGACTCTGTCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-3836s1c1
Sequence:CCGGCCACCTTATGCAATTCGGGAACTCGAGTTCCCGAATTGCATAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4456s1c1
Sequence:CCGGGCAAGCTCTTGCTGGATGAAACTCGAGTTTCATCCAGCAAGAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-2170s1c1
Sequence:CCGGCAAACGGTTCATGCTTGACATCTCGAGATGTCAAGCATGAACCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1530s1c1
Sequence:CCGGGAAACAAATTCAGCCGAGATTCTCGAGAATCTCGGCTGAATTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2950s1c1
Sequence:CCGGCCTGTTTGAGTCTAAATCCAACTCGAGTTGGATTTAGACTCAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025135.2-4656s1c1
Sequence:CCGGCACCCGGTTTATTAGTTCAAACTCGAGTTTGAACTAATAAACCGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4720s1c1
Sequence:CCGGCAAATCACTTCTGTCACAGTTCTCGAGAACTGTGACAGAAGTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1031s1c1
Sequence:CCGGGTGGAGCAACTCAACATTTATCTCGAGATAAATGTTGAGTTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4719s1c1
Sequence:CCGGGCAAATCACTTCTGTCACAGTCTCGAGACTGTGACAGAAGTGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-3608s1c1
Sequence:CCGGGCCAAGGTTGACTTTGATCAACTCGAGTTGATCAAAGTCAACCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2161s1c1
Sequence:CCGGCCTCACCAACAAACGGTTCATCTCGAGATGAACCGTTTGTTGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025135
FHOD3 MISSION shRNA Lentiviral Transduction Particles
formin homology 2 domain containing 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2485s1c1
Sequence:CCGGGCCGAAGACAGAGTCTGATTACTCGAGTAATCAGACTCTGTCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-3836s1c1
Sequence:CCGGCCACCTTATGCAATTCGGGAACTCGAGTTCCCGAATTGCATAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137942    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4456s1c1
Sequence:CCGGGCAAGCTCTTGCTGGATGAAACTCGAGTTTCATCCAGCAAGAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-2170s1c1
Sequence:CCGGCAAACGGTTCATGCTTGACATCTCGAGATGTCAAGCATGAACCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1530s1c1
Sequence:CCGGGAAACAAATTCAGCCGAGATTCTCGAGAATCTCGGCTGAATTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2950s1c1
Sequence:CCGGCCTGTTTGAGTCTAAATCCAACTCGAGTTGGATTTAGACTCAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025135.2-4656s1c1
Sequence:CCGGCACCCGGTTTATTAGTTCAAACTCGAGTTTGAACTAATAAACCGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4720s1c1
Sequence:CCGGCAAATCACTTCTGTCACAGTTCTCGAGAACTGTGACAGAAGTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025135.2-1031s1c1
Sequence:CCGGGTGGAGCAACTCAACATTTATCTCGAGATAAATGTTGAGTTGCTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025135.2-4719s1c1
Sequence:CCGGGCAAATCACTTCTGTCACAGTCTCGAGACTGTGACAGAAGTGATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-3608s1c1
Sequence:CCGGGCCAAGGTTGACTTTGATCAACTCGAGTTGATCAAAGTCAACCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025135.2-2161s1c1
Sequence:CCGGCCTCACCAACAAACGGTTCATCTCGAGATGAACCGTTTGTTGGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175276
VALIDATED
FHOD3 MISSION shRNA Bacterial Glycerol Stock
formin homology 2 domain containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-206s1c1
Sequence:CCGGCGATCCTTTCAACAGCACCAACTCGAGTTGGTGCTGTTGAAAGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175276.3-4984s1c1
Sequence:CCGGGACCTGAACATCTGATGGTTACTCGAGTAACCATCAGATGTTCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-1254s1c1
Sequence:CCGGCGTAGACACTCAATCCAGAATCTCGAGATTCTGGATTGAGTGTCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4232s21c1
Sequence:CCGGAGACTGTGCAGAGCGAATTATCTCGAGATAATTCGCTCTGCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4107s21c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-4107s1c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175276.3-5261s21c1
Sequence:CCGGACCAAATGTCCAGATATAAATCTCGAGATTTATATCTGGACATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-3490s21c1
Sequence:CCGGGTAAACGGCAGGAGATCATTGCTCGAGCAATGATCTCCTGCCGTTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-4262s21c1
Sequence:CCGGGATCGTCCATCGGAGGATAATCTCGAGATTATCCTCCGATGGACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175276
VALIDATED
FHOD3 MISSION shRNA shRNA Plasmid DNA
formin homology 2 domain containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-206s1c1
Sequence:CCGGCGATCCTTTCAACAGCACCAACTCGAGTTGGTGCTGTTGAAAGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175276.3-4984s1c1
Sequence:CCGGGACCTGAACATCTGATGGTTACTCGAGTAACCATCAGATGTTCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-1254s1c1
Sequence:CCGGCGTAGACACTCAATCCAGAATCTCGAGATTCTGGATTGAGTGTCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4232s21c1
Sequence:CCGGAGACTGTGCAGAGCGAATTATCTCGAGATAATTCGCTCTGCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4107s21c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-4107s1c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175276.3-5261s21c1
Sequence:CCGGACCAAATGTCCAGATATAAATCTCGAGATTTATATCTGGACATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-3490s21c1
Sequence:CCGGGTAAACGGCAGGAGATCATTGCTCGAGCAATGATCTCCTGCCGTTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-4262s21c1
Sequence:CCGGGATCGTCCATCGGAGGATAATCTCGAGATTATCCTCCGATGGACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175276
VALIDATED
FHOD3 MISSION shRNA Lentiviral Transduction Particles
formin homology 2 domain containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-206s1c1
Sequence:CCGGCGATCCTTTCAACAGCACCAACTCGAGTTGGTGCTGTTGAAAGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198933    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175276.3-4984s1c1
Sequence:CCGGGACCTGAACATCTGATGGTTACTCGAGTAACCATCAGATGTTCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-1254s1c1
Sequence:CCGGCGTAGACACTCAATCCAGAATCTCGAGATTCTGGATTGAGTGTCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4232s21c1
Sequence:CCGGAGACTGTGCAGAGCGAATTATCTCGAGATAATTCGCTCTGCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175276.3-4107s21c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175276.3-4107s1c1
Sequence:CCGGGATCAACTTCAGGATAATTTACTCGAGTAAATTATCCTGAAGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175276.3-5261s21c1
Sequence:CCGGACCAAATGTCCAGATATAAATCTCGAGATTTATATCTGGACATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-3490s21c1
Sequence:CCGGGTAAACGGCAGGAGATCATTGCTCGAGCAATGATCTCCTGCCGTTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175276.3-4262s21c1
Sequence:CCGGGATCGTCCATCGGAGGATAATCTCGAGATTATCCTCCGATGGACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)