EMAIL THIS PAGE TO A FRIEND

FIBCD1

fibrinogen C domain containing 1

47 Gene Product Result for
UniProtKB ID: Q8N539, A3KFK0, Q6UXK6, Q96SJ7
Gene ID:
Human(84929) Summary: FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]
Mouse(98970) fibrinogen C domain containing 1
Rat(311861) fibrinogen C domain containing 1
chicken(427762) fibrinogen C domain containing 1
dog(491291) fibrinogen C domain containing 1
domestic cat(101098265) fibrinogen C domain containing 1
cow(531723) fibrinogen C domain containing 1
sheep(101122684) fibrinogen C domain containing 1
naked mole-rat(101723709) fibrinogen C domain containing 1
domestic guinea pig(100730189) fibrinogen C domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032843 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU199061 MISSION® esiRNA esiRNA targeting mouse Fibcd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032843 Rosetta Predictions human pricing
NM_001107829 Rosetta Predictions rat pricing
NM_178887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122548 predicted 1260
2 SASI_Hs01_00122549 predicted 1416
3 SASI_Hs01_00122550 predicted 885
4 SASI_Hs02_00360439 predicted 1681
5 SASI_Hs01_00122552 predicted 1385
6 SASI_Hs01_00122553 predicted 1278
7 SASI_Hs01_00122554 predicted 969
8 SASI_Hs01_00122555 predicted 1617
9 SASI_Hs01_00122556 predicted 1384
10 SASI_Hs01_00122557 predicted 1976
11 SASI_Hs01_00122551 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232685 predicted 1509
2 SASI_Rn02_00232686 predicted 1422
3 SASI_Rn02_00232687 predicted 1223
4 SASI_Rn02_00232688 predicted 2033
5 SASI_Rn02_00232689 predicted 2028
6 SASI_Rn02_00232690 predicted 1147
7 SASI_Rn02_00232691 predicted 1748
8 SASI_Rn02_00232692 predicted 1318
9 SASI_Rn02_00232693 predicted 989
10 SASI_Rn02_00232694 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060847 predicted 1236
2 SASI_Mm01_00060849 predicted 1632
3 SASI_Mm01_00060850 predicted 2068
4 SASI_Mm01_00060851 predicted 1449
5 SASI_Mm01_00060852 predicted 2001
6 SASI_Mm01_00060853 predicted 1549
7 SASI_Mm01_00060854 predicted 1339
8 SASI_Mm01_00060855 predicted 1918
9 SASI_Mm02_00349478 predicted 352
10 SASI_Mm01_00060856 predicted 1057
11 SASI_Mm01_00060848 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178887
FIBCD1 MISSION shRNA Bacterial Glycerol Stock
fibrinogen C domain containing 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1205s21c1
Sequence:CCGGGAGCTTCACGTGGACCTAGAACTCGAGTTCTAGGTCCACGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1246s21c1
Sequence:CCGGCTATGCCCACTACGGGAGTTTCTCGAGAAACTCCCGTAGTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-941s1c1
Sequence:CCGGTGATGGTGTCTACTCTATCTTCTCGAGAAGATAGAGTAGACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178887.2-2911s1c1
Sequence:CCGGGCACGAAACATGAGTAGAGTACTCGAGTACTCTACTCATGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1504s1c1
Sequence:CCGGGATGGCAGTATTCACTCAAGTCTCGAGACTTGAGTGAATACTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1418s1c1
Sequence:CCGGCTGTCACACATCCAACCTCAACTCGAGTTGAGGTTGGATGTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1301s1c1
Sequence:CCGGCGCAGGTGACTCCCTCCTGAACTCGAGTTCAGGAGGGAGTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178887
FIBCD1 MISSION shRNA shRNA Plasmid DNA
fibrinogen C domain containing 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1205s21c1
Sequence:CCGGGAGCTTCACGTGGACCTAGAACTCGAGTTCTAGGTCCACGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1246s21c1
Sequence:CCGGCTATGCCCACTACGGGAGTTTCTCGAGAAACTCCCGTAGTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-941s1c1
Sequence:CCGGTGATGGTGTCTACTCTATCTTCTCGAGAAGATAGAGTAGACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178887.2-2911s1c1
Sequence:CCGGGCACGAAACATGAGTAGAGTACTCGAGTACTCTACTCATGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1504s1c1
Sequence:CCGGGATGGCAGTATTCACTCAAGTCTCGAGACTTGAGTGAATACTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1418s1c1
Sequence:CCGGCTGTCACACATCCAACCTCAACTCGAGTTGAGGTTGGATGTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1301s1c1
Sequence:CCGGCGCAGGTGACTCCCTCCTGAACTCGAGTTCAGGAGGGAGTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178887
FIBCD1 MISSION shRNA Lentiviral Transduction Particles
fibrinogen C domain containing 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1205s21c1
Sequence:CCGGGAGCTTCACGTGGACCTAGAACTCGAGTTCTAGGTCCACGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178887.4-1246s21c1
Sequence:CCGGCTATGCCCACTACGGGAGTTTCTCGAGAAACTCCCGTAGTGGGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-941s1c1
Sequence:CCGGTGATGGTGTCTACTCTATCTTCTCGAGAAGATAGAGTAGACACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178887.2-2911s1c1
Sequence:CCGGGCACGAAACATGAGTAGAGTACTCGAGTACTCTACTCATGTTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1504s1c1
Sequence:CCGGGATGGCAGTATTCACTCAAGTCTCGAGACTTGAGTGAATACTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1418s1c1
Sequence:CCGGCTGTCACACATCCAACCTCAACTCGAGTTGAGGTTGGATGTGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178887.2-1301s1c1
Sequence:CCGGCGCAGGTGACTCCCTCCTGAACTCGAGTTCAGGAGGGAGTCACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032843
VALIDATED
FIBCD1 MISSION shRNA Bacterial Glycerol Stock
fibrinogen C domain containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1340s21c1
Sequence:CCGGGCTCACCGTGGCTGACTATTCCTCGAGGAATAGTCAGCCACGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1397s21c1
Sequence:CCGGCATGAGGTTCACCACCAAGGACTCGAGTCCTTGGTGGTGAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1144s21c1
Sequence:CCGGATGCGTACCGAGACGGCTTTGCTCGAGCAAAGCCGTCTCGGTACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-973s21c1
Sequence:CCGGACTGTCTGGACGTCCTCCTAACTCGAGTTAGGAGGACGTCCAGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1113s21c1
Sequence:CCGGGACGGCTCCGTGAACTTCTTCCTCGAGGAAGAAGTTCACGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-834s21c1
Sequence:CCGGGTGAACTCCGTCAGCGACATCCTCGAGGATGTCGCTGACGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1686s1c1
Sequence:CCGGCCTCACTCTTTCGTGAATGTTCTCGAGAACATTCACGAAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1422s1c1
Sequence:CCGGCAGCGACCATTCAGAGAACAACTCGAGTTGTTCTCTGAATGGTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1569s1c1
Sequence:CCGGCTGGCAGTACTCACTCAAGTTCTCGAGAACTTGAGTGAGTACTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-504s1c1
Sequence:CCGGCTCGCACCTCAGCATCCTCATCTCGAGATGAGGATGCTGAGGTGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1006s1c1
Sequence:CCGGGATGGCGTCTACTCTGTCTTTCTCGAGAAAGACAGAGTAGACGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032843
VALIDATED
FIBCD1 MISSION shRNA shRNA Plasmid DNA
fibrinogen C domain containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1340s21c1
Sequence:CCGGGCTCACCGTGGCTGACTATTCCTCGAGGAATAGTCAGCCACGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1397s21c1
Sequence:CCGGCATGAGGTTCACCACCAAGGACTCGAGTCCTTGGTGGTGAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1144s21c1
Sequence:CCGGATGCGTACCGAGACGGCTTTGCTCGAGCAAAGCCGTCTCGGTACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-973s21c1
Sequence:CCGGACTGTCTGGACGTCCTCCTAACTCGAGTTAGGAGGACGTCCAGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1113s21c1
Sequence:CCGGGACGGCTCCGTGAACTTCTTCCTCGAGGAAGAAGTTCACGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-834s21c1
Sequence:CCGGGTGAACTCCGTCAGCGACATCCTCGAGGATGTCGCTGACGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1686s1c1
Sequence:CCGGCCTCACTCTTTCGTGAATGTTCTCGAGAACATTCACGAAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1422s1c1
Sequence:CCGGCAGCGACCATTCAGAGAACAACTCGAGTTGTTCTCTGAATGGTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1569s1c1
Sequence:CCGGCTGGCAGTACTCACTCAAGTTCTCGAGAACTTGAGTGAGTACTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-504s1c1
Sequence:CCGGCTCGCACCTCAGCATCCTCATCTCGAGATGAGGATGCTGAGGTGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1006s1c1
Sequence:CCGGGATGGCGTCTACTCTGTCTTTCTCGAGAAAGACAGAGTAGACGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032843
VALIDATED
FIBCD1 MISSION shRNA Lentiviral Transduction Particles
fibrinogen C domain containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1340s21c1
Sequence:CCGGGCTCACCGTGGCTGACTATTCCTCGAGGAATAGTCAGCCACGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1397s21c1
Sequence:CCGGCATGAGGTTCACCACCAAGGACTCGAGTCCTTGGTGGTGAACCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1144s21c1
Sequence:CCGGATGCGTACCGAGACGGCTTTGCTCGAGCAAAGCCGTCTCGGTACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-973s21c1
Sequence:CCGGACTGTCTGGACGTCCTCCTAACTCGAGTTAGGAGGACGTCCAGACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-1113s21c1
Sequence:CCGGGACGGCTCCGTGAACTTCTTCCTCGAGGAAGAAGTTCACGGAGCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032843.4-834s21c1
Sequence:CCGGGTGAACTCCGTCAGCGACATCCTCGAGGATGTCGCTGACGGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1686s1c1
Sequence:CCGGCCTCACTCTTTCGTGAATGTTCTCGAGAACATTCACGAAAGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1422s1c1
Sequence:CCGGCAGCGACCATTCAGAGAACAACTCGAGTTGTTCTCTGAATGGTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1569s1c1
Sequence:CCGGCTGGCAGTACTCACTCAAGTTCTCGAGAACTTGAGTGAGTACTGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-504s1c1
Sequence:CCGGCTCGCACCTCAGCATCCTCATCTCGAGATGAGGATGCTGAGGTGCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_032843.3-1006s1c1
Sequence:CCGGGATGGCGTCTACTCTGTCTTTCTCGAGAAAGACAGAGTAGACGCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks