EMAIL THIS PAGE TO A FRIEND

FIBIN

fin bud initiation factor homolog (zebrafish)

48 Gene Product Result for
UniProtKB ID: Q8TAL6
Gene ID:
Mouse(67606) fin bud initiation factor homolog (zebrafish)
Rat(499856) fin bud initiation factor homolog (zebrafish)
domestic guinea pig(100725554) fin bud initiation factor homolog (zebrafish)
naked mole-rat(101716274) fin bud initiation factor homolog (zebrafish)
sheep(101115568) fin bud initiation factor homolog (zebrafish)
chicken(426933) fin bud initiation factor homolog (zebrafish)
domestic cat(101081924) fin bud initiation factor homolog (zebrafish)
cow(507975) fin bud initiation factor homolog (zebrafish)
Horse(100057578) fin bud initiation factor homolog (zebrafish)
dog(612246) fin bud initiation factor homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA040120 Anti-FIBIN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203371 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054241 MISSION® esiRNA esiRNA human AC016450.10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203371 Rosetta Predictions human pricing
NM_001025042 Rosetta Predictions rat pricing
NM_026271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194883 predicted 1335
2 SASI_Hs01_00194886 predicted 1565
3 SASI_Hs01_00194887 predicted 512
4 SASI_Hs01_00194888 predicted 842
5 SASI_Hs01_00194889 predicted 851
6 SASI_Hs01_00194891 predicted 1517
7 SASI_Hs01_00194892 predicted 1090
8 SASI_Hs02_00373297 predicted 1440
9 SASI_Hs02_00373298 predicted 791
10 SASI_Hs02_00373299 predicted 1195
11 SASI_Hs01_00194884 predicted 1483
12 SASI_Hs01_00194885 predicted 833
13 SASI_Hs01_00194890 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202970 predicted 582
2 SASI_Rn01_00108836 predicted 419
3 SASI_Rn01_00108837 predicted 1010
4 SASI_Rn01_00108838 predicted 421
5 SASI_Rn01_00108839 predicted 1001
6 SASI_Rn01_00108840 predicted 1056
7 SASI_Rn01_00108841 predicted 744
8 SASI_Rn01_00108842 predicted 434
9 SASI_Rn01_00108843 predicted 1040
10 SASI_Rn02_00202971 predicted 991
11 SASI_Rn01_00108834 predicted 649
12 SASI_Rn01_00108835 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176369 predicted 1265
2 SASI_Mm01_00176370 predicted 270
3 SASI_Mm01_00176371 predicted 599
4 SASI_Mm01_00176372 predicted 426
5 SASI_Mm01_00176373 predicted 282
6 SASI_Mm01_00176374 predicted 1296
7 SASI_Mm01_00176376 predicted 1281
8 SASI_Mm01_00176377 predicted 535
9 SASI_Mm01_00176378 predicted 578
10 SASI_Mm02_00329961 predicted 1215
11 SASI_Mm01_00176375 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203371
FIBIN MISSION shRNA Bacterial Glycerol Stock
fin bud initiation factor homolog (zebrafish)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-920s1c1
Sequence:CCGGCAACGAGGACTTTCTGGGAATCTCGAGATTCCCAGAAAGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1885s1c1
Sequence:CCGGCCTATGATTTAGGTTACCAATCTCGAGATTGGTAACCTAAATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1199s1c1
Sequence:CCGGGCACTTTGAGAATACATCTAACTCGAGTTAGATGTATTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1787s1c1
Sequence:CCGGGCTGATTTGCTCTTTCTCATTCTCGAGAATGAGAAAGAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-2479s1c1
Sequence:CCGGGCTAATTCTTACTCTCACCTTCTCGAGAAGGTGAGAGTAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1884s1c1
Sequence:CCGGGCCTATGATTTAGGTTACCAACTCGAGTTGGTAACCTAAATCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-780s1c1
Sequence:CCGGGAAGAGAGCTATGGCAAGTACCTCGAGGTACTTGCCATAGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1191s1c1
Sequence:CCGGCCCGATTTGCACTTTGAGAATCTCGAGATTCTCAAAGTGCAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-570s1c1
Sequence:CCGGGACTATGAGGAGAACGATGACCTCGAGGTCATCGTTCTCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203371
FIBIN MISSION shRNA shRNA Plasmid DNA
fin bud initiation factor homolog (zebrafish)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-920s1c1
Sequence:CCGGCAACGAGGACTTTCTGGGAATCTCGAGATTCCCAGAAAGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1885s1c1
Sequence:CCGGCCTATGATTTAGGTTACCAATCTCGAGATTGGTAACCTAAATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1199s1c1
Sequence:CCGGGCACTTTGAGAATACATCTAACTCGAGTTAGATGTATTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1787s1c1
Sequence:CCGGGCTGATTTGCTCTTTCTCATTCTCGAGAATGAGAAAGAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-2479s1c1
Sequence:CCGGGCTAATTCTTACTCTCACCTTCTCGAGAAGGTGAGAGTAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1884s1c1
Sequence:CCGGGCCTATGATTTAGGTTACCAACTCGAGTTGGTAACCTAAATCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-780s1c1
Sequence:CCGGGAAGAGAGCTATGGCAAGTACCTCGAGGTACTTGCCATAGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1191s1c1
Sequence:CCGGCCCGATTTGCACTTTGAGAATCTCGAGATTCTCAAAGTGCAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-570s1c1
Sequence:CCGGGACTATGAGGAGAACGATGACCTCGAGGTCATCGTTCTCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203371
FIBIN MISSION shRNA Lentiviral Transduction Particles
fin bud initiation factor homolog (zebrafish)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-920s1c1
Sequence:CCGGCAACGAGGACTTTCTGGGAATCTCGAGATTCCCAGAAAGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158481    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1885s1c1
Sequence:CCGGCCTATGATTTAGGTTACCAATCTCGAGATTGGTAACCTAAATCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159627    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1199s1c1
Sequence:CCGGGCACTTTGAGAATACATCTAACTCGAGTTAGATGTATTCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160974    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1787s1c1
Sequence:CCGGGCTGATTTGCTCTTTCTCATTCTCGAGAATGAGAAAGAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-2479s1c1
Sequence:CCGGGCTAATTCTTACTCTCACCTTCTCGAGAAGGTGAGAGTAAGAATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1884s1c1
Sequence:CCGGGCCTATGATTTAGGTTACCAACTCGAGTTGGTAACCTAAATCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-780s1c1
Sequence:CCGGGAAGAGAGCTATGGCAAGTACCTCGAGGTACTTGCCATAGCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164630    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203371.1-1191s1c1
Sequence:CCGGCCCGATTTGCACTTTGAGAATCTCGAGATTCTCAAAGTGCAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203371.1-570s1c1
Sequence:CCGGGACTATGAGGAGAACGATGACCTCGAGGTCATCGTTCTCCTCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026271
FIBIN MISSION shRNA Bacterial Glycerol Stock
fin bud initiation factor homolog (zebrafish)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026271.1-436s1c1
Sequence:CCGGCTTCGAGAGGAGTTCACAGTACTCGAGTACTGTGAACTCCTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1350s1c1
Sequence:CCGGCATGCAAATCACCACCAGTAACTCGAGTTACTGGTGGTGATTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1067s1c1
Sequence:CCGGGCTCTAACAGAATCTCTTCTTCTCGAGAAGAAGAGATTCTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-657s1c1
Sequence:CCGGGCAGGAAAGCAGACTCAATGACTCGAGTCATTGAGTCTGCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-744s1c1
Sequence:CCGGGCTCAGAGACAAATACGAGCTCTCGAGAGCTCGTATTTGTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-316s1c1
Sequence:CCGGGATGGAGACTATGAGGAGAATCTCGAGATTCTCCTCATAGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-275s1c1
Sequence:CCGGCAGAAATGTCTAATGGGACTTCTCGAGAAGTCCCATTAGACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026271
FIBIN MISSION shRNA shRNA Plasmid DNA
fin bud initiation factor homolog (zebrafish)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026271.1-436s1c1
Sequence:CCGGCTTCGAGAGGAGTTCACAGTACTCGAGTACTGTGAACTCCTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1350s1c1
Sequence:CCGGCATGCAAATCACCACCAGTAACTCGAGTTACTGGTGGTGATTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1067s1c1
Sequence:CCGGGCTCTAACAGAATCTCTTCTTCTCGAGAAGAAGAGATTCTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-657s1c1
Sequence:CCGGGCAGGAAAGCAGACTCAATGACTCGAGTCATTGAGTCTGCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-744s1c1
Sequence:CCGGGCTCAGAGACAAATACGAGCTCTCGAGAGCTCGTATTTGTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-316s1c1
Sequence:CCGGGATGGAGACTATGAGGAGAATCTCGAGATTCTCCTCATAGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-275s1c1
Sequence:CCGGCAGAAATGTCTAATGGGACTTCTCGAGAAGTCCCATTAGACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026271
FIBIN MISSION shRNA Lentiviral Transduction Particles
fin bud initiation factor homolog (zebrafish)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026271.1-436s1c1
Sequence:CCGGCTTCGAGAGGAGTTCACAGTACTCGAGTACTGTGAACTCCTCTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1350s1c1
Sequence:CCGGCATGCAAATCACCACCAGTAACTCGAGTTACTGGTGGTGATTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026271.1-1067s1c1
Sequence:CCGGGCTCTAACAGAATCTCTTCTTCTCGAGAAGAAGAGATTCTGTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-657s1c1
Sequence:CCGGGCAGGAAAGCAGACTCAATGACTCGAGTCATTGAGTCTGCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-744s1c1
Sequence:CCGGGCTCAGAGACAAATACGAGCTCTCGAGAGCTCGTATTTGTCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-316s1c1
Sequence:CCGGGATGGAGACTATGAGGAGAATCTCGAGATTCTCCTCATAGTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026271.1-275s1c1
Sequence:CCGGCAGAAATGTCTAATGGGACTTCTCGAGAAGTCCCATTAGACATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks