EMAIL THIS PAGE TO A FRIEND

FIBP

fibroblast growth factor (acidic) intracellular binding protein

58 Gene Product Result for
Synonyms: FGFIBP FIBP-1
UniProtKB ID: O43427, A8K0J7, Q27Q85, Q6IBQ3, Q9HD65
Gene ID:
Human(9158) Summary: Acidic fibroblast growth factor is mitogenic for a variety of different cell types and acts by stimulating mitogenesis or inducing morphological changes and differentiation. The FIBP protein is an intracellular protein that binds selectively to acidic fibroblast growth factor (aFGF). It is postulated that FIBP may be involved in the mitogenic action of aFGF. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(58249) fibroblast growth factor (acidic) intracellular binding protein
Rat(282837) fibroblast growth factor (acidic) intracellular binding protein
fruit fly(40163) CG8660 gene product from transcript CG8660-RF
cow(510968) fibroblast growth factor (acidic) intracellular binding protein
Horse(100051868) fibroblast growth factor (acidic) intracellular binding protein
domestic cat(101100918) fibroblast growth factor (acidic) intracellular binding protein
dog(476019) fibroblast growth factor (acidic) intracellular binding protein
Goat(100861272) fibroblast growth factor (acidic) intracellular binding protein
sheep(101110717) fibroblast growth factor (acidic) intracellular binding protein
naked mole-rat(101710341) fibroblast growth factor (acidic) intracellular binding protein
domestic guinea pig(100733686) fibroblast growth factor (acidic) intracellular binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004214 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087271 MISSION® esiRNA esiRNA human FIBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004214 Rosetta Predictions human pricing
NM_198897 Rosetta Predictions human pricing
NM_172334 Rosetta Predictions rat pricing
NM_021438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095624 predicted 1052
2 SASI_Hs01_00095625 predicted 1063
3 SASI_Hs01_00095626 predicted 968
4 SASI_Hs01_00095627 predicted 386
5 SASI_Hs01_00095628 predicted 398
6 SASI_Hs01_00095629 predicted 963
7 SASI_Hs01_00095630 predicted 517
8 SASI_Hs01_00095631 predicted 545
9 SASI_Hs01_00095632 predicted 499
10 SASI_Hs01_00095633 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238465 predicted 1075
2 SASI_Hs01_00238466 predicted 1091
3 SASI_Hs01_00238467 predicted 987
4 SASI_Hs01_00238468 predicted 381
5 SASI_Hs01_00238469 predicted 397
6 SASI_Hs01_00238470 predicted 987
7 SASI_Hs01_00238471 predicted 519
8 SASI_Hs01_00238472 predicted 539
9 SASI_Hs01_00238473 predicted 499
10 SASI_Hs01_00238474 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088958 predicted 696
2 SASI_Rn01_00088960 predicted 549
3 SASI_Rn01_00088961 predicted 501
4 SASI_Rn02_00269225 predicted 315
5 SASI_Rn02_00269226 predicted 212
6 SASI_Rn01_00088962 predicted 910
7 SASI_Rn01_00088963 predicted 200
8 SASI_Rn01_00088964 predicted 530
9 SASI_Rn01_00088965 predicted 294
10 SASI_Rn01_00088966 predicted 521
11 SASI_Rn01_00088957 predicted 627
12 SASI_Rn01_00088959 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103194 predicted 408
2 SASI_Mm01_00103195 predicted 324
3 SASI_Mm01_00103196 predicted 259
4 SASI_Mm01_00103197 predicted 404
5 SASI_Mm01_00103198 predicted 426
6 SASI_Mm01_00103199 predicted 489
7 SASI_Mm01_00103200 predicted 283
8 SASI_Mm01_00103201 predicted 598
9 SASI_Mm01_00103202 predicted 627
10 SASI_Mm01_00103203 predicted 779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004214
VALIDATED
FIBP MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor (acidic) intracellular binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1214s1c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1073s1c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-766s1c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-667s1c1
Sequence:CCGGCCGCTTTGAGACAGGGAAGAACTCGAGTTCTTCCCTGTCTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-524s1c1
Sequence:CCGGCGGAGACAGTTTGACAACTTTCTCGAGAAAGTTGTCAAACTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1214s21c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1073s21c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-766s21c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-393s21c1
Sequence:CCGGTACTCATCGAGAGGTACTATGCTCGAGCATAGTACCTCTCGATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-162s21c1
Sequence:CCGGTTATCGACGAGGACGTGTATCCTCGAGGATACACGTCCTCGTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004214
VALIDATED
FIBP MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor (acidic) intracellular binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1214s1c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1073s1c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-766s1c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-667s1c1
Sequence:CCGGCCGCTTTGAGACAGGGAAGAACTCGAGTTCTTCCCTGTCTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-524s1c1
Sequence:CCGGCGGAGACAGTTTGACAACTTTCTCGAGAAAGTTGTCAAACTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1214s21c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1073s21c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-766s21c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-393s21c1
Sequence:CCGGTACTCATCGAGAGGTACTATGCTCGAGCATAGTACCTCTCGATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-162s21c1
Sequence:CCGGTTATCGACGAGGACGTGTATCCTCGAGGATACACGTCCTCGTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004214
VALIDATED
FIBP MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor (acidic) intracellular binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117867    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1214s1c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-1073s1c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-766s1c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-667s1c1
Sequence:CCGGCCGCTTTGAGACAGGGAAGAACTCGAGTTCTTCCCTGTCTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004214.4-524s1c1
Sequence:CCGGCGGAGACAGTTTGACAACTTTCTCGAGAAAGTTGTCAAACTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1214s21c1
Sequence:CCGGGCCCACGCTGACAATAAAGTTCTCGAGAACTTTATTGTCAGCGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-1073s21c1
Sequence:CCGGCGGTTCTTCCTGAATCAGTATCTCGAGATACTGATTCAGGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-766s21c1
Sequence:CCGGCGACTCACAGATGGATGACATCTCGAGATGTCATCCATCTGTGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-393s21c1
Sequence:CCGGTACTCATCGAGAGGTACTATGCTCGAGCATAGTACCTCTCGATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004214.4-162s21c1
Sequence:CCGGTTATCGACGAGGACGTGTATCCTCGAGGATACACGTCCTCGTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021438
VALIDATED
FIBP MISSION shRNA Bacterial Glycerol Stock
fibroblast growth factor (acidic) intracellular binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-40s1c1
Sequence:CCGGCTTATAGATGAAGACGTGTATCTCGAGATACACGTCTTCATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-69s1c1
Sequence:CCGGGCTGGATGGTTACTCAGTGAACTCGAGTTCACTGAGTAACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-546s1c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021438.1-693s1c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-280s1c1
Sequence:CCGGGAGAGGTACTACACCTTTGATCTCGAGATCAAAGGTGTAGTACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-693s21c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021438.3-546s21c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-498s21c1
Sequence:CCGGTGACCGGTTAGCCAGGGATTACTCGAGTAATCCCTGGCTAACCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-659s21c1
Sequence:CCGGACGACATGGATGTGGACTTAGCTCGAGCTAAGTCCACATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-869s21c1
Sequence:CCGGAGGATGTCAGAGACCTATTTGCTCGAGCAAATAGGTCTCTGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021438
VALIDATED
FIBP MISSION shRNA shRNA Plasmid DNA
fibroblast growth factor (acidic) intracellular binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-40s1c1
Sequence:CCGGCTTATAGATGAAGACGTGTATCTCGAGATACACGTCTTCATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-69s1c1
Sequence:CCGGGCTGGATGGTTACTCAGTGAACTCGAGTTCACTGAGTAACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-546s1c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021438.1-693s1c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-280s1c1
Sequence:CCGGGAGAGGTACTACACCTTTGATCTCGAGATCAAAGGTGTAGTACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-693s21c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021438.3-546s21c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-498s21c1
Sequence:CCGGTGACCGGTTAGCCAGGGATTACTCGAGTAATCCCTGGCTAACCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-659s21c1
Sequence:CCGGACGACATGGATGTGGACTTAGCTCGAGCTAAGTCCACATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-869s21c1
Sequence:CCGGAGGATGTCAGAGACCTATTTGCTCGAGCAAATAGGTCTCTGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021438
VALIDATED
FIBP MISSION shRNA Lentiviral Transduction Particles
fibroblast growth factor (acidic) intracellular binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-40s1c1
Sequence:CCGGCTTATAGATGAAGACGTGTATCTCGAGATACACGTCTTCATCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-69s1c1
Sequence:CCGGGCTGGATGGTTACTCAGTGAACTCGAGTTCACTGAGTAACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-546s1c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021438.1-693s1c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021438.1-280s1c1
Sequence:CCGGGAGAGGTACTACACCTTTGATCTCGAGATCAAAGGTGTAGTACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-693s21c1
Sequence:CCGGCCAAGACTTGAAGGAGCTCAACTCGAGTTGAGCTCCTTCAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021438.3-546s21c1
Sequence:CCGGCCGCTTTGAAACAGGAAAGAACTCGAGTTCTTTCCTGTTTCAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-498s21c1
Sequence:CCGGTGACCGGTTAGCCAGGGATTACTCGAGTAATCCCTGGCTAACCGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-659s21c1
Sequence:CCGGACGACATGGATGTGGACTTAGCTCGAGCTAAGTCCACATCCATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021438.3-869s21c1
Sequence:CCGGAGGATGTCAGAGACCTATTTGCTCGAGCAAATAGGTCTCTGACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks