EMAIL THIS PAGE TO A FRIEND

FICD

FIC domain containing

50 Gene Product Result for
Synonyms: HIP13 HYPE UNQ3041
UniProtKB ID: Q9BVA6, O75406
Gene ID:
Mouse(231630) FIC domain containing
Rat(288741) FIC domain containing
Zebrafish(334648) FIC domain containing
chicken(416889) FIC domain containing
cow(505923) FIC domain containing
Horse(100059882) FIC domain containing
domestic cat(101088882) FIC domain containing
dog(486320) FIC domain containing
sheep(101103594) FIC domain containing
domestic guinea pig(100729299) FIC domain containing
naked mole-rat(101711873) FIC domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001010825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001010825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007076 Rosetta Predictions human pricing
NM_001010946 Rosetta Predictions rat pricing
NM_001010825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044555 predicted 290
2 SASI_Hs01_00044556 predicted 719
3 SASI_Hs01_00044557 predicted 1137
4 SASI_Hs01_00044558 predicted 792
5 SASI_Hs01_00044559 predicted 671
6 SASI_Hs01_00044560 predicted 1192
7 SASI_Hs01_00044561 predicted 1073
8 SASI_Hs01_00044562 predicted 1215
9 SASI_Hs01_00044563 predicted 805
10 SASI_Hs01_00044564 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059504 predicted 984
2 SASI_Rn01_00059505 predicted 1147
3 SASI_Rn01_00059506 predicted 980
4 SASI_Rn01_00059507 predicted 1131
5 SASI_Rn02_00199822 predicted 1645
6 SASI_Rn01_00059508 predicted 899
7 SASI_Rn01_00059509 predicted 1403
8 SASI_Rn01_00059510 predicted 923
9 SASI_Rn02_00199823 predicted 1250
10 SASI_Rn01_00059512 predicted 549
11 SASI_Rn01_00059511 predicted 425
12 SASI_Rn01_00059513 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064958 predicted 846
2 SASI_Mm02_00286892 predicted 723
3 SASI_Mm01_00064959 predicted 743
4 SASI_Mm01_00064960 predicted 977
5 SASI_Mm01_00064961 predicted 895
6 SASI_Mm01_00064962 predicted 2099
7 SASI_Mm01_00064964 predicted 1174
8 SASI_Mm01_00064965 predicted 1577
9 SASI_Mm01_00064966 predicted 1385
10 SASI_Mm01_00064967 predicted 1621
11 SASI_Mm01_00064963 predicted 2075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010825
FICD MISSION shRNA Bacterial Glycerol Stock
FIC domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-732s21c1
Sequence:CCGGGCTTTGTAGACGCACTGAATGCTCGAGCATTCAGTGCGTCTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-1554s21c1
Sequence:CCGGGGCCTTTCATCCGCTTCATAGCTCGAGCTATGAAGCGGATGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-786s21c1
Sequence:CCGGTCATCCAGGCTGACTACTTATCTCGAGATAAGTAGTCAGCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010825.3-1845s21c1
Sequence:CCGGTTATAGTTCAGCCAAGTTATTCTCGAGAATAACTTGGCTGAACTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010825
FICD MISSION shRNA shRNA Plasmid DNA
FIC domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-732s21c1
Sequence:CCGGGCTTTGTAGACGCACTGAATGCTCGAGCATTCAGTGCGTCTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-1554s21c1
Sequence:CCGGGGCCTTTCATCCGCTTCATAGCTCGAGCTATGAAGCGGATGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-786s21c1
Sequence:CCGGTCATCCAGGCTGACTACTTATCTCGAGATAAGTAGTCAGCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010825.3-1845s21c1
Sequence:CCGGTTATAGTTCAGCCAAGTTATTCTCGAGAATAACTTGGCTGAACTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010825
FICD MISSION shRNA Lentiviral Transduction Particles
FIC domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-732s21c1
Sequence:CCGGGCTTTGTAGACGCACTGAATGCTCGAGCATTCAGTGCGTCTACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-1554s21c1
Sequence:CCGGGGCCTTTCATCCGCTTCATAGCTCGAGCTATGAAGCGGATGAAAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010825.3-786s21c1
Sequence:CCGGTCATCCAGGCTGACTACTTATCTCGAGATAAGTAGTCAGCCTGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010825.3-1845s21c1
Sequence:CCGGTTATAGTTCAGCCAAGTTATTCTCGAGAATAACTTGGCTGAACTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007076
FICD MISSION shRNA Bacterial Glycerol Stock
FIC domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c2
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c1
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1200s1c1
Sequence:CCGGGCAGCCTTAGCCCATTATAAACTCGAGTTTATAATGGGCTAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1210s1c1
Sequence:CCGGCCCATTATAAACTCGTTTACACTCGAGTGTAAACGAGTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c1
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1232s1c1
Sequence:CCGGCCACCCTTTCATTGATGGCAACTCGAGTTGCCATCAATGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-579s1c1
Sequence:CCGGGAGTTTGGCATCTTCTCGGAACTCGAGTTCCGAGAAGATGCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c2
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-593s1c1
Sequence:CCGGCTCGGAAGAAGACAAGGACATCTCGAGATGTCCTTGTCTTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007076
FICD MISSION shRNA shRNA Plasmid DNA
FIC domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c2
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c1
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1200s1c1
Sequence:CCGGGCAGCCTTAGCCCATTATAAACTCGAGTTTATAATGGGCTAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1210s1c1
Sequence:CCGGCCCATTATAAACTCGTTTACACTCGAGTGTAAACGAGTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c1
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1232s1c1
Sequence:CCGGCCACCCTTTCATTGATGGCAACTCGAGTTGCCATCAATGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-579s1c1
Sequence:CCGGGAGTTTGGCATCTTCTCGGAACTCGAGTTCCGAGAAGATGCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c2
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-593s1c1
Sequence:CCGGCTCGGAAGAAGACAAGGACATCTCGAGATGTCCTTGTCTTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007076
FICD MISSION shRNA Lentiviral Transduction Particles
FIC domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c2
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c1
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1200s1c1
Sequence:CCGGGCAGCCTTAGCCCATTATAAACTCGAGTTTATAATGGGCTAAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1210s1c1
Sequence:CCGGCCCATTATAAACTCGTTTACACTCGAGTGTAAACGAGTTTATAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-708s1c1
Sequence:CCGGGAAGAGATCGACCAGAGGTATCTCGAGATACCTCTGGTCGATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-1232s1c1
Sequence:CCGGCCACCCTTTCATTGATGGCAACTCGAGTTGCCATCAATGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-579s1c1
Sequence:CCGGGAGTTTGGCATCTTCTCGGAACTCGAGTTCCGAGAAGATGCCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-662s1c2
Sequence:CCGGCCATGAGAAAGCACTGGTCAACTCGAGTTGACCAGTGCTTTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007076.2-593s1c1
Sequence:CCGGCTCGGAAGAAGACAAGGACATCTCGAGATGTCCTTGTCTTCTTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks