EMAIL THIS PAGE TO A FRIEND

FIGF

c-fos induced growth factor (vascular endothelial growth factor D)

88 Gene Product Result for
Synonyms: VEGF-D VEGFD
UniProtKB ID: O43915, B2R7Z3
Gene ID:
Human(2277) Summary: The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family and is active in angiogenesis, lymphangiogenesis, and endothelial cell growth. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-2 and VEGFR-3 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor C. Read-through transcription has been observed between this locus and the upstream PIR (GeneID 8544) locus. [provided by RefSeq, Feb 2011]
Mouse(14205) c-fos induced growth factor
Rat(360457) c-fos induced growth factor
sheep(101102873) c-fos induced growth factor (vascular endothelial growth factor D)
Domestic Rabbit(100338090) c-fos induced growth factor (vascular endothelial growth factor D)
domestic guinea pig(100733371) c-fos induced growth factor (vascular endothelial growth factor D)
naked mole-rat(101726005) c-fos induced growth factor (vascular endothelial growth factor D)
Zebrafish(678512) c-fos induced growth factor
chicken(395255) c-fos induced growth factor (vascular endothelial growth factor D)
domestic cat(493703) c-fos induced growth factor (vascular endothelial growth factor D)
cow(286799) c-fos induced growth factor (vascular endothelial growth factor D)
Horse(100050877) c-fos induced growth factor (vascular endothelial growth factor D)
dog(491749) c-fos induced growth factor (vascular endothelial growth factor D)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004469 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052781 MISSION® esiRNA esiRNA human FIGF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004469 Rosetta Predictions human pricing
NM_031761 Rosetta Predictions rat pricing
NM_010216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115495 predicted 635
2 SASI_Hs01_00115496 predicted 1278
3 SASI_Hs01_00115497 predicted 1095
4 SASI_Hs01_00115498 predicted 1134
5 SASI_Hs01_00115499 predicted 1176
6 SASI_Hs01_00115501 predicted 1194
7 SASI_Hs02_00337679 predicted 1039
8 SASI_Hs01_00115503 predicted 660
9 SASI_Hs01_00115504 predicted 1300
10 SASI_Hs02_00337680 predicted 1008
11 SASI_Hs01_00115500 predicted 783
12 SASI_Hs01_00115502 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044568 predicted 1246
2 SASI_Rn01_00044570 predicted 418
3 SASI_Rn01_00044571 predicted 291
4 SASI_Rn01_00044572 predicted 603
5 SASI_Rn01_00044573 predicted 388
6 SASI_Rn01_00044574 predicted 965
7 SASI_Rn01_00044575 predicted 1264
8 SASI_Rn02_00265179 predicted 416
9 SASI_Rn01_00044576 predicted 1248
10 SASI_Rn01_00044577 predicted 720
11 SASI_Rn01_00044569 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122373 predicted 619
2 SASI_Mm01_00122374 predicted 880
3 SASI_Mm01_00122375 predicted 983
4 SASI_Mm01_00122376 predicted 305
5 SASI_Mm01_00122377 predicted 957
6 SASI_Mm01_00122378 predicted 574
7 SASI_Mm01_00122380 predicted 971
8 SASI_Mm01_00122381 predicted 796
9 SASI_Mm01_00122382 predicted 948
10 SASI_Mm02_00318065 predicted 394
11 SASI_Mm01_00122379 predicted 788
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010216
FIGF MISSION shRNA Bacterial Glycerol Stock
c-fos induced growth factor (vascular endothelial growth factor D)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1707s21c1
Sequence:CCGGAGGGCAATGCTCATGAGTTATCTCGAGATAACTCATGAGCATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010216.1-1124s21c1
Sequence:CCGGCATGTCCGGGAGATCTCATTCCTCGAGGAATGAGATCTCCCGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1663s21c1
Sequence:CCGGGTAGTAGGTGCCACTCGATTGCTCGAGCAATCGAGTGGCACCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1565s21c1
Sequence:CCGGTTGTAGCTTCAGATGTCTTTGCTCGAGCAAAGACATCTGAAGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010216.1-1731s1c1
Sequence:CCGGGCTTCTTTCTTATGCGGAATTCTCGAGAATTCCGCATAAGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-884s1c1
Sequence:CCGGCCCGCCATCCTTACTCAATTACTCGAGTAATTGAGTAAGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-823s1c1
Sequence:CCGGCCCGAGTTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-555s1c1
Sequence:CCGGCACCAGATTTGCGGCAACTTTCTCGAGAAAGTTGCCGCAAATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-312s1c1
Sequence:CCGGCCTCATGATGTTCCATGTGTACTCGAGTACACATGGAACATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010216
FIGF MISSION shRNA shRNA Plasmid DNA
c-fos induced growth factor (vascular endothelial growth factor D)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1707s21c1
Sequence:CCGGAGGGCAATGCTCATGAGTTATCTCGAGATAACTCATGAGCATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010216.1-1124s21c1
Sequence:CCGGCATGTCCGGGAGATCTCATTCCTCGAGGAATGAGATCTCCCGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1663s21c1
Sequence:CCGGGTAGTAGGTGCCACTCGATTGCTCGAGCAATCGAGTGGCACCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1565s21c1
Sequence:CCGGTTGTAGCTTCAGATGTCTTTGCTCGAGCAAAGACATCTGAAGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010216.1-1731s1c1
Sequence:CCGGGCTTCTTTCTTATGCGGAATTCTCGAGAATTCCGCATAAGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-884s1c1
Sequence:CCGGCCCGCCATCCTTACTCAATTACTCGAGTAATTGAGTAAGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-823s1c1
Sequence:CCGGCCCGAGTTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-555s1c1
Sequence:CCGGCACCAGATTTGCGGCAACTTTCTCGAGAAAGTTGCCGCAAATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-312s1c1
Sequence:CCGGCCTCATGATGTTCCATGTGTACTCGAGTACACATGGAACATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010216
FIGF MISSION shRNA Lentiviral Transduction Particles
c-fos induced growth factor (vascular endothelial growth factor D)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1707s21c1
Sequence:CCGGAGGGCAATGCTCATGAGTTATCTCGAGATAACTCATGAGCATTGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010216.1-1124s21c1
Sequence:CCGGCATGTCCGGGAGATCTCATTCCTCGAGGAATGAGATCTCCCGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1663s21c1
Sequence:CCGGGTAGTAGGTGCCACTCGATTGCTCGAGCAATCGAGTGGCACCTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010216.1-1565s21c1
Sequence:CCGGTTGTAGCTTCAGATGTCTTTGCTCGAGCAAAGACATCTGAAGCTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010216.1-1731s1c1
Sequence:CCGGGCTTCTTTCTTATGCGGAATTCTCGAGAATTCCGCATAAGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-884s1c1
Sequence:CCGGCCCGCCATCCTTACTCAATTACTCGAGTAATTGAGTAAGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-823s1c1
Sequence:CCGGCCCGAGTTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-555s1c1
Sequence:CCGGCACCAGATTTGCGGCAACTTTCTCGAGAAAGTTGCCGCAAATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010216.1-312s1c1
Sequence:CCGGCCTCATGATGTTCCATGTGTACTCGAGTACACATGGAACATCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004469
FIGF MISSION shRNA Bacterial Glycerol Stock
c-fos induced growth factor (vascular endothelial growth factor D)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1059s21c1
Sequence:CCGGGCCAATCATACAGGTTGTAAGCTCGAGCTTACAACCTGTATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1410s21c1
Sequence:CCGGTGCCAGAAGCACAAGCTATTTCTCGAGAAATAGCTTGTGCTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1035s1c1
Sequence:CCGGCCTGAATTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1096s1c1
Sequence:CCGGCCCGCCATCCATACTCAATTACTCGAGTAATTGAGTATGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1287s1c1
Sequence:CCGGCCACACATGATGTTTGACGAACTCGAGTTCGTCAAACATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1176s1c1
Sequence:CCGGCCTATTGACATGCTATGGGATCTCGAGATCCCATAGCATGTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-648s1c1
Sequence:CCGGGCTTCTAGTTTGGAGGAACTACTCGAGTAGTTCCTCCAAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004469
FIGF MISSION shRNA shRNA Plasmid DNA
c-fos induced growth factor (vascular endothelial growth factor D)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1059s21c1
Sequence:CCGGGCCAATCATACAGGTTGTAAGCTCGAGCTTACAACCTGTATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1410s21c1
Sequence:CCGGTGCCAGAAGCACAAGCTATTTCTCGAGAAATAGCTTGTGCTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1035s1c1
Sequence:CCGGCCTGAATTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1096s1c1
Sequence:CCGGCCCGCCATCCATACTCAATTACTCGAGTAATTGAGTATGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1287s1c1
Sequence:CCGGCCACACATGATGTTTGACGAACTCGAGTTCGTCAAACATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1176s1c1
Sequence:CCGGCCTATTGACATGCTATGGGATCTCGAGATCCCATAGCATGTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-648s1c1
Sequence:CCGGGCTTCTAGTTTGGAGGAACTACTCGAGTAGTTCCTCCAAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004469
FIGF MISSION shRNA Lentiviral Transduction Particles
c-fos induced growth factor (vascular endothelial growth factor D)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1059s21c1
Sequence:CCGGGCCAATCATACAGGTTGTAAGCTCGAGCTTACAACCTGTATGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004469.2-1410s21c1
Sequence:CCGGTGCCAGAAGCACAAGCTATTTCTCGAGAAATAGCTTGTGCTTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1035s1c1
Sequence:CCGGCCTGAATTAGTGCCTGTTAAACTCGAGTTTAACAGGCACTAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1096s1c1
Sequence:CCGGCCCGCCATCCATACTCAATTACTCGAGTAATTGAGTATGGATGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1287s1c1
Sequence:CCGGCCACACATGATGTTTGACGAACTCGAGTTCGTCAAACATCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-1176s1c1
Sequence:CCGGCCTATTGACATGCTATGGGATCTCGAGATCCCATAGCATGTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004469.2-648s1c1
Sequence:CCGGGCTTCTAGTTTGGAGGAACTACTCGAGTAGTTCCTCCAAACTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks