EMAIL THIS PAGE TO A FRIEND

FIGLA

folliculogenesis specific basic helix-loop-helix

Synonyms: BHLHC8 FIGALPHA POF6
UniProtKB ID: Q6QHK4
Gene ID:
Human(344018) Summary: This gene encodes a protein that functions in postnatal oocyte-specific gene expression. The protein is a basic helix-loop-helix transcription factor that regulates multiple oocyte-specific genes, including genes involved in folliculogenesis and those that encode the zona pellucida. Mutations in this gene cause premature ovarian failure type 6. [provided by RefSeq, Sep 2009]
Mouse(26910) folliculogenesis specific basic helix-loop-helix
Rat(500239) folliculogenesis specific basic helix-loop-helix
Zebrafish(387259) factor in the germline alpha
cow(528891) folliculogenesis specific basic helix-loop-helix
domestic cat(101095648) folliculogenesis specific basic helix-loop-helix
dog(100687488) folliculogenesis specific basic helix-loop-helix
naked mole-rat(101723356) folliculogenesis specific basic helix-loop-helix
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012013 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012013 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012013 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004311 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004311 Rosetta Predictions human pricing
XM_575589 Rosetta Predictions rat pricing
NM_012013 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304522 predicted 319
2 SASI_Hs01_00233531 predicted 300
3 SASI_Hs01_00233532 predicted 316
4 SASI_Hs01_00233533 predicted 265
5 SASI_Hs01_00233534 predicted 312
6 SASI_Hs01_00233535 predicted 305
7 SASI_Hs01_00233536 predicted 305
8 SASI_Hs01_00233537 predicted 320
9 SASI_Hs01_00233539 predicted 292
10 SASI_Hs01_00233540 predicted 300
11 SASI_Hs01_00233538 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403843 predicted 283
2 SASI_Rn02_00403844 predicted 323
3 SASI_Rn02_00403845 predicted 454
4 SASI_Rn02_00403846 predicted 200
5 SASI_Rn02_00403847 predicted 219
6 SASI_Rn02_00403848 predicted 300
7 SASI_Rn02_00403849 predicted 310
8 SASI_Rn02_00403850 predicted 298
9 SASI_Rn02_00403851 predicted 285
10 SASI_Rn02_00403852 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012013 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111984 predicted 328
2 SASI_Mm01_00111985 predicted 242
3 SASI_Mm01_00111986 predicted 360
4 SASI_Mm01_00111987 predicted 243
5 SASI_Mm01_00111988 predicted 243
6 SASI_Mm01_00111989 predicted 346
7 SASI_Mm01_00111990 predicted 397
8 SASI_Mm01_00111991 predicted 351
9 SASI_Mm01_00111992 predicted 507
10 SASI_Mm01_00111993 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012013
FIGLA MISSION shRNA Bacterial Glycerol Stock
folliculogenesis specific basic helix-loop-helix
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-609s1c1
Sequence:CCGGACCCGAGACTAGGAGTTACTTCTCGAGAAGTAACTCCTAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-282s1c1
Sequence:CCGGCCGTGGCTTTGCCAAGCTGAACTCGAGTTCAGCTTGGCAAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-337s1c1
Sequence:CCGGCCCAGTAAAGTTGATATCCTTCTCGAGAAGGATATCAACTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-336s1c1
Sequence:CCGGGCCCAGTAAAGTTGATATCCTCTCGAGAGGATATCAACTTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-353s1c1
Sequence:CCGGTCCTTAAAGGTGCCACAGAATCTCGAGATTCTGTGGCACCTTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-580s21c1
Sequence:CCGGCCATTGTACAGCTACCATCAGCTCGAGCTGATGGTAGCTGTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-208s21c1
Sequence:CCGGGATGACCTGCATCTGGTGTTGCTCGAGCAACACCAGATGCAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-251s21c1
Sequence:CCGGCCAAAGAGCGTGAACGGATAACTCGAGTTATCCGTTCACGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012013
FIGLA MISSION shRNA shRNA Plasmid DNA
folliculogenesis specific basic helix-loop-helix
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-609s1c1
Sequence:CCGGACCCGAGACTAGGAGTTACTTCTCGAGAAGTAACTCCTAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-282s1c1
Sequence:CCGGCCGTGGCTTTGCCAAGCTGAACTCGAGTTCAGCTTGGCAAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-337s1c1
Sequence:CCGGCCCAGTAAAGTTGATATCCTTCTCGAGAAGGATATCAACTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-336s1c1
Sequence:CCGGGCCCAGTAAAGTTGATATCCTCTCGAGAGGATATCAACTTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-353s1c1
Sequence:CCGGTCCTTAAAGGTGCCACAGAATCTCGAGATTCTGTGGCACCTTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-580s21c1
Sequence:CCGGCCATTGTACAGCTACCATCAGCTCGAGCTGATGGTAGCTGTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-208s21c1
Sequence:CCGGGATGACCTGCATCTGGTGTTGCTCGAGCAACACCAGATGCAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-251s21c1
Sequence:CCGGCCAAAGAGCGTGAACGGATAACTCGAGTTATCCGTTCACGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012013
FIGLA MISSION shRNA Lentiviral Transduction Particles
folliculogenesis specific basic helix-loop-helix
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-609s1c1
Sequence:CCGGACCCGAGACTAGGAGTTACTTCTCGAGAAGTAACTCCTAGTCTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-282s1c1
Sequence:CCGGCCGTGGCTTTGCCAAGCTGAACTCGAGTTCAGCTTGGCAAAGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-337s1c1
Sequence:CCGGCCCAGTAAAGTTGATATCCTTCTCGAGAAGGATATCAACTTTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-336s1c1
Sequence:CCGGGCCCAGTAAAGTTGATATCCTCTCGAGAGGATATCAACTTTACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012013.1-353s1c1
Sequence:CCGGTCCTTAAAGGTGCCACAGAATCTCGAGATTCTGTGGCACCTTTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-580s21c1
Sequence:CCGGCCATTGTACAGCTACCATCAGCTCGAGCTGATGGTAGCTGTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-208s21c1
Sequence:CCGGGATGACCTGCATCTGGTGTTGCTCGAGCAACACCAGATGCAGGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012013.1-251s21c1
Sequence:CCGGCCAAAGAGCGTGAACGGATAACTCGAGTTATCCGTTCACGCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004311
FIGLA MISSION shRNA Bacterial Glycerol Stock
folliculogenesis specific basic helix-loop-helix
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-307s1c1
Sequence:CCGGCCAGCAAAGTTGATATCCTTACTCGAGTAAGGATATCAACTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-333s1c1
Sequence:CCGGGCGACTGAATATATACAGGTTCTCGAGAACCTGTATATATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-492s1c1
Sequence:CCGGGCTTTCGGCTTGAAGAATGAACTCGAGTTCATTCTTCAAGCCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-476s1c1
Sequence:CCGGCCAACATATCAGCTGTGCTTTCTCGAGAAAGCACAGCTGATATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-571s1c1
Sequence:CCGGGTGTGATGTCTACGACTGAAACTCGAGTTTCAGTCGTAGACATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004311
FIGLA MISSION shRNA shRNA Plasmid DNA
folliculogenesis specific basic helix-loop-helix
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-307s1c1
Sequence:CCGGCCAGCAAAGTTGATATCCTTACTCGAGTAAGGATATCAACTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-333s1c1
Sequence:CCGGGCGACTGAATATATACAGGTTCTCGAGAACCTGTATATATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-492s1c1
Sequence:CCGGGCTTTCGGCTTGAAGAATGAACTCGAGTTCATTCTTCAAGCCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-476s1c1
Sequence:CCGGCCAACATATCAGCTGTGCTTTCTCGAGAAAGCACAGCTGATATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-571s1c1
Sequence:CCGGGTGTGATGTCTACGACTGAAACTCGAGTTTCAGTCGTAGACATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004311
FIGLA MISSION shRNA Lentiviral Transduction Particles
folliculogenesis specific basic helix-loop-helix
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-307s1c1
Sequence:CCGGCCAGCAAAGTTGATATCCTTACTCGAGTAAGGATATCAACTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-333s1c1
Sequence:CCGGGCGACTGAATATATACAGGTTCTCGAGAACCTGTATATATTCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-492s1c1
Sequence:CCGGGCTTTCGGCTTGAAGAATGAACTCGAGTTCATTCTTCAAGCCGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-476s1c1
Sequence:CCGGCCAACATATCAGCTGTGCTTTCTCGAGAAAGCACAGCTGATATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004311.1-571s1c1
Sequence:CCGGGTGTGATGTCTACGACTGAAACTCGAGTTTCAGTCGTAGACATCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks