EMAIL THIS PAGE TO A FRIEND
211 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009041 MISSION® esiRNA esiRNA targeting human FIGN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018086 Rosetta Predictions human pricing
NM_001106484 Rosetta Predictions rat pricing
XM_229979 Rosetta Predictions rat pricing
NM_021716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137422 predicted 2186
2 SASI_Hs01_00137424 predicted 2134
3 SASI_Hs02_00351258 predicted 1716
4 SASI_Hs01_00137425 predicted 2227
5 SASI_Hs01_00137426 predicted 1506
6 SASI_Hs01_00137427 predicted 1820
7 SASI_Hs02_00351259 predicted 864
8 SASI_Hs01_00137428 predicted 784
9 SASI_Hs01_00137429 predicted 663
10 SASI_Hs01_00137430 predicted 2309
11 SASI_Hs01_00137421 predicted 887
12 SASI_Hs01_00137423 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219418 predicted 2545
2 SASI_Rn02_00219419 predicted 1267
3 SASI_Rn02_00219420 predicted 866
4 SASI_Rn02_00219421 predicted 786
5 SASI_Rn02_00219422 predicted 2225
6 SASI_Rn02_00219423 predicted 595
7 SASI_Rn02_00219424 predicted 1556
8 SASI_Rn02_00219425 predicted 1798
9 SASI_Rn02_00219426 predicted 428
10 SASI_Rn02_00219427 predicted 2511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184311 predicted 3085
2 SASI_Rn01_00184312 predicted 2914
3 SASI_Rn01_00184313 predicted 3098
4 SASI_Rn01_00184314 predicted 3110
5 SASI_Rn01_00184315 predicted 3128
6 SASI_Rn01_00184316 predicted 2795
7 SASI_Rn01_00184317 predicted 2904
8 SASI_Rn01_00184318 predicted 2940
9 SASI_Rn01_00184319 predicted 3006
10 SASI_Rn01_00184320 predicted 2767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168509 predicted 1711
2 SASI_Mm01_00168510 predicted 1721
3 SASI_Mm01_00168512 predicted 791
4 SASI_Mm02_00326406 predicted 1404
5 SASI_Mm02_00326407 predicted 1030
6 SASI_Mm02_00326408 predicted 1304
7 SASI_Mm01_00168513 predicted 946
8 SASI_Mm01_00168514 predicted 1798
9 SASI_Mm01_00168515 predicted 1987
10 SASI_Mm01_00168516 predicted 2314
11 SASI_Mm01_00168511 predicted 2151
12 SASI_Mm01_00168517 predicted 801
13 SASI_Mm01_00168518 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018086
VALIDATED
FIGN MISSION shRNA Bacterial Glycerol Stock
fidgetin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-674s21c1
Sequence:CCGGGAACTGTGTTCCGGATGTTATCTCGAGATAACATCCGGAACACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018086.2-872s21c1
Sequence:CCGGAGGATACAACGGATCATATTTCTCGAGAAATATGATCCGTTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2118s21c1
Sequence:CCGGAGTCGGATGAGAACCGAATTTCTCGAGAAATTCGGTTCTCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2173s21c1
Sequence:CCGGAGGACCAAATCGTAGTAATTTCTCGAGAAATTACTACGATTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018086.2-2726s21c1
Sequence:CCGGCTTTAGAGTCAGGGTAGATTTCTCGAGAAATCTACCCTGACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1450s1c1
Sequence:CCGGATTGCCGGTTCTGGACTAGTCCTCGAGGACTAGTCCAGAACCGGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018086.x-855s1c1
Sequence:CCGGGCCCGACAACAGCATTTCAAACTCGAGTTTGAAATGCTGTTGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1228s1c1
Sequence:CCGGATTATCACCCAAGGACCTCCACTCGAGTGGAGGTCCTTGGGTGATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1172s1c1
Sequence:CCGGTGGACGAGCAACTGAAGAATACTCGAGTATTCTTCAGTTGCTCGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018086
VALIDATED
FIGN MISSION shRNA shRNA Plasmid DNA
fidgetin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-674s21c1
Sequence:CCGGGAACTGTGTTCCGGATGTTATCTCGAGATAACATCCGGAACACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018086.2-872s21c1
Sequence:CCGGAGGATACAACGGATCATATTTCTCGAGAAATATGATCCGTTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2118s21c1
Sequence:CCGGAGTCGGATGAGAACCGAATTTCTCGAGAAATTCGGTTCTCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2173s21c1
Sequence:CCGGAGGACCAAATCGTAGTAATTTCTCGAGAAATTACTACGATTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018086.2-2726s21c1
Sequence:CCGGCTTTAGAGTCAGGGTAGATTTCTCGAGAAATCTACCCTGACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1450s1c1
Sequence:CCGGATTGCCGGTTCTGGACTAGTCCTCGAGGACTAGTCCAGAACCGGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018086.x-855s1c1
Sequence:CCGGGCCCGACAACAGCATTTCAAACTCGAGTTTGAAATGCTGTTGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1228s1c1
Sequence:CCGGATTATCACCCAAGGACCTCCACTCGAGTGGAGGTCCTTGGGTGATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1172s1c1
Sequence:CCGGTGGACGAGCAACTGAAGAATACTCGAGTATTCTTCAGTTGCTCGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018086
VALIDATED
FIGN MISSION shRNA Lentiviral Transduction Particles
fidgetin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-674s21c1
Sequence:CCGGGAACTGTGTTCCGGATGTTATCTCGAGATAACATCCGGAACACAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018086.2-872s21c1
Sequence:CCGGAGGATACAACGGATCATATTTCTCGAGAAATATGATCCGTTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2118s21c1
Sequence:CCGGAGTCGGATGAGAACCGAATTTCTCGAGAAATTCGGTTCTCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018086.2-2173s21c1
Sequence:CCGGAGGACCAAATCGTAGTAATTTCTCGAGAAATTACTACGATTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018086.2-2726s21c1
Sequence:CCGGCTTTAGAGTCAGGGTAGATTTCTCGAGAAATCTACCCTGACTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1450s1c1
Sequence:CCGGATTGCCGGTTCTGGACTAGTCCTCGAGGACTAGTCCAGAACCGGCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018086.x-855s1c1
Sequence:CCGGGCCCGACAACAGCATTTCAAACTCGAGTTTGAAATGCTGTTGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1228s1c1
Sequence:CCGGATTATCACCCAAGGACCTCCACTCGAGTGGAGGTCCTTGGGTGATAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018086.x-1172s1c1
Sequence:CCGGTGGACGAGCAACTGAAGAATACTCGAGTATTCTTCAGTTGCTCGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021716
FIGN MISSION shRNA Bacterial Glycerol Stock
fidgetin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021716.1-2776s1c1
Sequence:CCGGGCTGACAGAAAGCATATACATCTCGAGATGTATATGCTTTCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-2459s1c1
Sequence:CCGGCCCGTTACATATCAAGACTTTCTCGAGAAAGTCTTGATATGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1778s1c1
Sequence:CCGGGCGGTTATTAAGGAGGAGGTTCTCGAGAACCTCCTCCTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-450s1c1
Sequence:CCGGCCTGGGCGAATGATGACATATCTCGAGATATGTCATCATTCGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1411s1c1
Sequence:CCGGCTTAGCATTTAAGCCAACAAACTCGAGTTTGTTGGCTTAAATGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021716
FIGN MISSION shRNA shRNA Plasmid DNA
fidgetin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021716.1-2776s1c1
Sequence:CCGGGCTGACAGAAAGCATATACATCTCGAGATGTATATGCTTTCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-2459s1c1
Sequence:CCGGCCCGTTACATATCAAGACTTTCTCGAGAAAGTCTTGATATGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1778s1c1
Sequence:CCGGGCGGTTATTAAGGAGGAGGTTCTCGAGAACCTCCTCCTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-450s1c1
Sequence:CCGGCCTGGGCGAATGATGACATATCTCGAGATATGTCATCATTCGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1411s1c1
Sequence:CCGGCTTAGCATTTAAGCCAACAAACTCGAGTTTGTTGGCTTAAATGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021716
FIGN MISSION shRNA Lentiviral Transduction Particles
fidgetin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021716.1-2776s1c1
Sequence:CCGGGCTGACAGAAAGCATATACATCTCGAGATGTATATGCTTTCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-2459s1c1
Sequence:CCGGCCCGTTACATATCAAGACTTTCTCGAGAAAGTCTTGATATGTAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1778s1c1
Sequence:CCGGGCGGTTATTAAGGAGGAGGTTCTCGAGAACCTCCTCCTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-450s1c1
Sequence:CCGGCCTGGGCGAATGATGACATATCTCGAGATATGTCATCATTCGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021716.1-1411s1c1
Sequence:CCGGCTTAGCATTTAAGCCAACAAACTCGAGTTTGTTGGCTTAAATGCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks