EMAIL THIS PAGE TO A FRIEND

FIGNL1

fidgetin-like 1

74 Gene Product Result for
UniProtKB ID: Q6PIW4, D3DVM6, Q86V18, Q8ND59, Q9H8P1, Q9H917
Gene ID:
Mouse(60530) fidgetin-like 1
Rat(289777) fidgetin-like 1
Zebrafish(569539) fidgetin-like 1
chicken(420946) fidgetin-like 1
dog(483232) fidgetin-like 1
cow(538986) fidgetin-like 1
Horse(100052497) fidgetin-like 1
domestic cat(101082734) fidgetin-like 1
naked mole-rat(101698918) fidgetin-like 1
sheep(101107186) fidgetin-like 1
Domestic Rabbit(100356925) fidgetin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042762 Rosetta Predictions human pricing
NM_022116 Rosetta Predictions human pricing
NM_001011913 Rosetta Predictions rat pricing
XM_573663 Rosetta Predictions rat pricing
NM_021891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311179 predicted 1546
2 SASI_Hs02_00311180 predicted 1194
3 SASI_Hs02_00311181 predicted 2102
4 SASI_Hs02_00311182 predicted 599
5 SASI_Hs02_00311183 predicted 954
6 SASI_Hs02_00311184 predicted 1633
7 SASI_Hs02_00311185 predicted 2202
8 SASI_Hs02_00311186 predicted 1354
9 SASI_Hs02_00311187 predicted 1608
10 SASI_Hs02_00311188 predicted 1876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057043 predicted 1541
2 SASI_Hs01_00057044 predicted 1191
3 SASI_Hs01_00057045 predicted 2089
4 SASI_Hs01_00057046 predicted 583
5 SASI_Hs01_00057047 predicted 942
6 SASI_Hs02_00355509 predicted 1623
7 SASI_Hs01_00057049 predicted 2195
8 SASI_Hs01_00057052 predicted 1340
9 SASI_Hs02_00355510 predicted 1595
10 SASI_Hs02_00355511 predicted 1863
11 SASI_Hs01_00057048 predicted 2346
12 SASI_Hs01_00057050 predicted 528
13 SASI_Hs01_00057051 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083652 predicted 669
2 SASI_Rn01_00083654 predicted 2253
3 SASI_Rn01_00083655 predicted 1090
4 SASI_Rn01_00083656 predicted 903
5 SASI_Rn01_00083657 predicted 1696
6 SASI_Rn01_00083658 predicted 1924
7 SASI_Rn01_00083659 predicted 2090
8 SASI_Rn01_00083660 predicted 245
9 SASI_Rn02_00199908 predicted 494
10 SASI_Rn02_00199909 predicted 2113
11 SASI_Rn01_00083653 predicted 2058
12 SASI_Rn01_00083661 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573663 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150433 predicted 1105
2 SASI_Rn01_00150434 predicted 1202
3 SASI_Rn01_00150435 predicted 1214
4 SASI_Rn01_00150436 predicted 1244
5 SASI_Rn01_00150437 predicted 1198
6 SASI_Rn01_00150438 predicted 1144
7 SASI_Rn01_00150439 predicted 1187
8 SASI_Rn01_00150440 predicted 1207
9 SASI_Rn01_00150441 predicted 1255
10 SASI_Rn01_00150442 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111343 predicted 290
2 SASI_Mm02_00326457 predicted 949
3 SASI_Mm01_00111344 predicted 633
4 SASI_Mm01_00111345 predicted 241
5 SASI_Mm01_00111346 predicted 1687
6 SASI_Mm01_00111347 predicted 2091
7 SASI_Mm01_00111348 predicted 1419
8 SASI_Mm02_00326458 predicted 1333
9 SASI_Mm01_00111349 predicted 1239
10 SASI_Mm01_00111350 predicted 2008
11 SASI_Mm01_00111351 predicted 2274
12 SASI_Mm01_00111352 predicted 2249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021891
VALIDATED
FIGNL1 MISSION shRNA Bacterial Glycerol Stock
fidgetin-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1335s1c1
Sequence:CCGGGCCAAGGATGGTTGAACTTATCTCGAGATAAGTTCAACCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021891.2-2285s1c1
Sequence:CCGGGCTGTGCTACTTGTATTGTTTCTCGAGAAACAATACAAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1133s1c1
Sequence:CCGGCCCAGCATACATCTAAATCTTCTCGAGAAGATTTAGATGTATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-2009s1c1
Sequence:CCGGGCGCAGATATGACACAGCTTTCTCGAGAAAGCTGTGTCATATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1426s1c1
Sequence:CCGGGCCACAATAAAGGAAATCGTTCTCGAGAACGATTTCCTTTATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2275s21c1
Sequence:CCGGGTTATCTAGTAGTCGTCTTTACTCGAGTAAAGACGACTACTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2381s21c1
Sequence:CCGGCTTGACTACTGACTGATATATCTCGAGATATATCAGTCAGTAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2131s21c1
Sequence:CCGGGTTCGACCAATAGCTTATATTCTCGAGAATATAAGCTATTGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-1414s21c1
Sequence:CCGGCCAGTACATTGGGACGATATTCTCGAGAATATCGTCCCAATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-321s21c1
Sequence:CCGGCCGTGCACTACTACTGCATATCTCGAGATATGCAGTAGTAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021891
VALIDATED
FIGNL1 MISSION shRNA shRNA Plasmid DNA
fidgetin-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1335s1c1
Sequence:CCGGGCCAAGGATGGTTGAACTTATCTCGAGATAAGTTCAACCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021891.2-2285s1c1
Sequence:CCGGGCTGTGCTACTTGTATTGTTTCTCGAGAAACAATACAAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1133s1c1
Sequence:CCGGCCCAGCATACATCTAAATCTTCTCGAGAAGATTTAGATGTATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-2009s1c1
Sequence:CCGGGCGCAGATATGACACAGCTTTCTCGAGAAAGCTGTGTCATATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1426s1c1
Sequence:CCGGGCCACAATAAAGGAAATCGTTCTCGAGAACGATTTCCTTTATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2275s21c1
Sequence:CCGGGTTATCTAGTAGTCGTCTTTACTCGAGTAAAGACGACTACTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2381s21c1
Sequence:CCGGCTTGACTACTGACTGATATATCTCGAGATATATCAGTCAGTAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2131s21c1
Sequence:CCGGGTTCGACCAATAGCTTATATTCTCGAGAATATAAGCTATTGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-1414s21c1
Sequence:CCGGCCAGTACATTGGGACGATATTCTCGAGAATATCGTCCCAATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-321s21c1
Sequence:CCGGCCGTGCACTACTACTGCATATCTCGAGATATGCAGTAGTAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021891
VALIDATED
FIGNL1 MISSION shRNA Lentiviral Transduction Particles
fidgetin-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1335s1c1
Sequence:CCGGGCCAAGGATGGTTGAACTTATCTCGAGATAAGTTCAACCATCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021891.2-2285s1c1
Sequence:CCGGGCTGTGCTACTTGTATTGTTTCTCGAGAAACAATACAAGTAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1133s1c1
Sequence:CCGGCCCAGCATACATCTAAATCTTCTCGAGAAGATTTAGATGTATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-2009s1c1
Sequence:CCGGGCGCAGATATGACACAGCTTTCTCGAGAAAGCTGTGTCATATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021891.2-1426s1c1
Sequence:CCGGGCCACAATAAAGGAAATCGTTCTCGAGAACGATTTCCTTTATTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375391    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2275s21c1
Sequence:CCGGGTTATCTAGTAGTCGTCTTTACTCGAGTAAAGACGACTACTAGATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2381s21c1
Sequence:CCGGCTTGACTACTGACTGATATATCTCGAGATATATCAGTCAGTAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-2131s21c1
Sequence:CCGGGTTCGACCAATAGCTTATATTCTCGAGAATATAAGCTATTGGTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-1414s21c1
Sequence:CCGGCCAGTACATTGGGACGATATTCTCGAGAATATCGTCCCAATGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021891.3-321s21c1
Sequence:CCGGCCGTGCACTACTACTGCATATCTCGAGATATGCAGTAGTAGTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022116
FIGNL1 MISSION shRNA Bacterial Glycerol Stock
fidgetin-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-859s1c1
Sequence:CCGGCCGGAGAGCAATCGTTTGAAACTCGAGTTTCAAACGATTGCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-372s1c1
Sequence:CCGGGCAGAAGAATTACTTCGCAATCTCGAGATTGCGAAGTAATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022116.2-598s1c1
Sequence:CCGGGCAGGATCTCAACAAACAGATCTCGAGATCTGTTTGTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022116.2-3006s1c1
Sequence:CCGGGCCTGTAATACTGCTCTCTTTCTCGAGAAAGAGAGCAGTATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-432s1c1
Sequence:CCGGCCGTGCACAGATATTACGCATCTCGAGATGCGTAATATCTGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-2215s1c1
Sequence:CCGGGCTACCATAACACCGGATCAACTCGAGTTGATCCGGTGTTATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022116.3-2083s21c1
Sequence:CCGGAGCCAGGAAACAGATAGTAATCTCGAGATTACTATCTGTTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022116.3-2582s21c1
Sequence:CCGGCCTGATACGTAAGCCTATTTGCTCGAGCAAATAGGCTTACGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022116
FIGNL1 MISSION shRNA shRNA Plasmid DNA
fidgetin-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-859s1c1
Sequence:CCGGCCGGAGAGCAATCGTTTGAAACTCGAGTTTCAAACGATTGCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-372s1c1
Sequence:CCGGGCAGAAGAATTACTTCGCAATCTCGAGATTGCGAAGTAATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022116.2-598s1c1
Sequence:CCGGGCAGGATCTCAACAAACAGATCTCGAGATCTGTTTGTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022116.2-3006s1c1
Sequence:CCGGGCCTGTAATACTGCTCTCTTTCTCGAGAAAGAGAGCAGTATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-432s1c1
Sequence:CCGGCCGTGCACAGATATTACGCATCTCGAGATGCGTAATATCTGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-2215s1c1
Sequence:CCGGGCTACCATAACACCGGATCAACTCGAGTTGATCCGGTGTTATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022116.3-2083s21c1
Sequence:CCGGAGCCAGGAAACAGATAGTAATCTCGAGATTACTATCTGTTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022116.3-2582s21c1
Sequence:CCGGCCTGATACGTAAGCCTATTTGCTCGAGCAAATAGGCTTACGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022116
FIGNL1 MISSION shRNA Lentiviral Transduction Particles
fidgetin-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-859s1c1
Sequence:CCGGCCGGAGAGCAATCGTTTGAAACTCGAGTTTCAAACGATTGCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-372s1c1
Sequence:CCGGGCAGAAGAATTACTTCGCAATCTCGAGATTGCGAAGTAATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022116.2-598s1c1
Sequence:CCGGGCAGGATCTCAACAAACAGATCTCGAGATCTGTTTGTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022116.2-3006s1c1
Sequence:CCGGGCCTGTAATACTGCTCTCTTTCTCGAGAAAGAGAGCAGTATTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-432s1c1
Sequence:CCGGCCGTGCACAGATATTACGCATCTCGAGATGCGTAATATCTGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022116.2-2215s1c1
Sequence:CCGGGCTACCATAACACCGGATCAACTCGAGTTGATCCGGTGTTATGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022116.3-2083s21c1
Sequence:CCGGAGCCAGGAAACAGATAGTAATCTCGAGATTACTATCTGTTTCCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022116.3-2582s21c1
Sequence:CCGGCCTGATACGTAAGCCTATTTGCTCGAGCAAATAGGCTTACGTATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks