EMAIL THIS PAGE TO A FRIEND

FIGNL2

fidgetin-like 2

73 Gene Product Result for
UniProtKB ID: A6NMB9
Gene ID:
Mouse(668225) fidgetin-like 2
Rat(300238) fidgetin-like 2
sheep(101114346) fidgetin-like 2
chicken(431296) fidgetin-like 2
cow(518615) fidgetin-like 2
domestic cat(101095506) fidgetin-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301296 ANTI-FIGNL2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013690 Rosetta Predictions human pricing
XM_001065624 Rosetta Predictions rat pricing
XM_235670 Rosetta Predictions rat pricing
XM_001000159 Rosetta Predictions mouse pricing
XM_001479184 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306452 predicted 1030
2 SASI_Hs02_00306453 predicted 1026
3 SASI_Hs02_00306454 predicted 1028
4 SASI_Hs02_00306455 predicted 1924
5 SASI_Hs01_00175529 predicted 2276
6 SASI_Hs02_00306456 predicted 471
7 SASI_Hs02_00306457 predicted 2273
8 SASI_Hs02_00306458 predicted 2156
9 SASI_Hs02_00306459 predicted 1926
10 SASI_Hs02_00306460 predicted 1458
11 SASI_Hs01_00175526 predicted 438
12 SASI_Hs01_00175527 predicted 438
13 SASI_Hs01_00175528 predicted 364
14 SASI_Hs01_00175530 predicted 736
15 SASI_Hs01_00175531 predicted 646
16 SASI_Hs01_00175532 predicted 916
17 SASI_Hs01_00175533 predicted 744
18 SASI_Hs01_00175534 predicted 903
19 SASI_Hs01_00175535 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065624 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314854 predicted 240
2 SASI_Rn02_00314855 predicted 963
3 SASI_Rn02_00314856 predicted 1638
4 SASI_Rn02_00314857 predicted 354
5 SASI_Rn02_00314858 predicted 2289
6 SASI_Rn02_00314859 predicted 2275
7 SASI_Rn02_00314860 predicted 699
8 SASI_Rn02_00314861 predicted 1798
9 SASI_Rn02_00314862 predicted 651
10 SASI_Rn02_00314863 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389576 predicted 351
2 SASI_Rn02_00389577 predicted 246
3 SASI_Rn02_00389578 predicted 1060
4 SASI_Rn02_00389579 predicted 352
5 SASI_Rn02_00389580 predicted 226
6 SASI_Rn02_00389581 predicted 583
7 SASI_Rn02_00389582 predicted 697
8 SASI_Rn02_00389583 predicted 657
9 SASI_Rn02_00389584 predicted 595
10 SASI_Rn02_00389585 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00354635 predicted 1004
2 SASI_Mm02_00354636 predicted 1434
3 SASI_Mm02_00354637 predicted 1604
4 SASI_Mm02_00354638 predicted 1251
5 SASI_Mm02_00354639 predicted 1547
6 SASI_Mm02_00354640 predicted 292
7 SASI_Mm02_00354641 predicted 1255
8 SASI_Mm02_00354642 predicted 289
9 SASI_Mm02_00354643 predicted 1488
10 SASI_Mm01_00235542 predicted 222
11 SASI_Mm01_00235543 predicted 262
12 SASI_Mm01_00235544 predicted 231
13 SASI_Mm01_00235545 predicted 965
14 SASI_Mm01_00235546 predicted 258
15 SASI_Mm01_00235547 predicted 247
16 SASI_Mm01_00235548 predicted 204
17 SASI_Mm01_00235549 predicted 234
18 SASI_Mm01_00235550 predicted 252
19 SASI_Mm01_00235551 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479184 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00408219 predicted 999
2 SASI_Mm02_00408220 predicted 1426
3 SASI_Mm02_00408221 predicted 1605
4 SASI_Mm02_00408222 predicted 1250
5 SASI_Mm02_00408223 predicted 1547
6 SASI_Mm02_00408224 predicted 295
7 SASI_Mm02_00408225 predicted 1246
8 SASI_Mm02_00408226 predicted 286
9 SASI_Mm02_00408227 predicted 1492
10 SASI_Mm02_00408228 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013690
FIGNL2 MISSION shRNA Bacterial Glycerol Stock
fidgetin-like 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1469s1c1
Sequence:CCGGCCTGAACTTTCCACTAGGCTTCTCGAGAAGCCTAGTGGAAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1491s1c1
Sequence:CCGGGAACCCTTCCAAGAACCATATCTCGAGATATGGTTCTTGGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1677s1c1
Sequence:CCGGCCGTGCATTTCCTAGAGTCTACTCGAGTAGACTCTAGGAAATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1163s1c1
Sequence:CCGGCTAAGCAGAAAGTCTCCAGAACTCGAGTTCTGGAGACTTTCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013690.1-550s1c1
Sequence:CCGGCCTCTACCCATCTGAAACCTACTCGAGTAGGTTTCAGATGGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013690.1-433s1c1
Sequence:CCGGCCATCCCATTCTCTGCATTCTCTCGAGAGAATGCAGAGAATGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013690
FIGNL2 MISSION shRNA shRNA Plasmid DNA
fidgetin-like 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1469s1c1
Sequence:CCGGCCTGAACTTTCCACTAGGCTTCTCGAGAAGCCTAGTGGAAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1491s1c1
Sequence:CCGGGAACCCTTCCAAGAACCATATCTCGAGATATGGTTCTTGGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1677s1c1
Sequence:CCGGCCGTGCATTTCCTAGAGTCTACTCGAGTAGACTCTAGGAAATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1163s1c1
Sequence:CCGGCTAAGCAGAAAGTCTCCAGAACTCGAGTTCTGGAGACTTTCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013690.1-550s1c1
Sequence:CCGGCCTCTACCCATCTGAAACCTACTCGAGTAGGTTTCAGATGGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013690.1-433s1c1
Sequence:CCGGCCATCCCATTCTCTGCATTCTCTCGAGAGAATGCAGAGAATGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013690
FIGNL2 MISSION shRNA Lentiviral Transduction Particles
fidgetin-like 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1469s1c1
Sequence:CCGGCCTGAACTTTCCACTAGGCTTCTCGAGAAGCCTAGTGGAAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1491s1c1
Sequence:CCGGGAACCCTTCCAAGAACCATATCTCGAGATATGGTTCTTGGAAGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1677s1c1
Sequence:CCGGCCGTGCATTTCCTAGAGTCTACTCGAGTAGACTCTAGGAAATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013690.1-1163s1c1
Sequence:CCGGCTAAGCAGAAAGTCTCCAGAACTCGAGTTCTGGAGACTTTCTGCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013690.1-550s1c1
Sequence:CCGGCCTCTACCCATCTGAAACCTACTCGAGTAGGTTTCAGATGGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013690.1-433s1c1
Sequence:CCGGCCATCCCATTCTCTGCATTCTCTCGAGAGAATGCAGAGAATGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks