EMAIL THIS PAGE TO A FRIEND

FILIP1

filamin A interacting protein 1

157 Gene Product Result for
Synonyms: FILIP
Gene ID:
Mouse(70598) filamin A interacting protein 1
Rat(246776) filamin A interacting protein 1
chicken(421860) filamin A interacting protein 1
domestic cat(101094101) filamin A interacting protein 1
cow(514193) filamin A interacting protein 1
Horse(100065183) filamin A interacting protein 1
dog(481882) filamin A interacting protein 1
domestic guinea pig(100722301) filamin A interacting protein 1
naked mole-rat(101725628) filamin A interacting protein 1
sheep(101110338) filamin A interacting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053564 Anti-FILIP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015687 Rosetta Predictions human pricing
NM_145682 Rosetta Predictions rat pricing
XM_579672 Rosetta Predictions rat pricing
NM_001081243 Rosetta Predictions mouse pricing
XM_486240 Rosetta Predictions mouse pricing
XM_901117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348338 predicted 3191
2 SASI_Hs01_00227885 predicted 1792
3 SASI_Hs01_00227886 predicted 3533
4 SASI_Hs01_00227887 predicted 889
5 SASI_Hs01_00227888 predicted 3502
6 SASI_Hs01_00227889 predicted 2533
7 SASI_Hs01_00227890 predicted 2155
8 SASI_Hs02_00348339 predicted 2933
9 SASI_Hs01_00227893 predicted 3911
10 SASI_Hs02_00348340 predicted 2573
11 SASI_Hs01_00227884 predicted 1627
12 SASI_Hs01_00227891 predicted 2953
13 SASI_Hs01_00227892 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081395 predicted 2891
2 SASI_Rn01_00081397 predicted 3083
3 SASI_Rn01_00081398 predicted 1553
4 SASI_Rn01_00081399 predicted 963
5 SASI_Rn01_00081400 predicted 3616
6 SASI_Rn01_00081401 predicted 3501
7 SASI_Rn01_00081402 predicted 1790
8 SASI_Rn01_00081403 predicted 3438
9 SASI_Rn02_00268737 predicted 2922
10 SASI_Rn01_00081404 predicted 3787
11 SASI_Rn01_00081396 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136737 predicted 1793
2 SASI_Rn01_00136738 predicted 511
3 SASI_Rn01_00136739 predicted 2021
4 SASI_Rn01_00136740 predicted 1017
5 SASI_Rn01_00136741 predicted 448
6 SASI_Rn01_00136742 predicted 3092
7 SASI_Rn01_00136743 predicted 2995
8 SASI_Rn01_00136744 predicted 2923
9 SASI_Rn01_00136745 predicted 3279
10 SASI_Rn01_00136746 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296577 predicted 1163
2 SASI_Mm02_00296578 predicted 2153
3 SASI_Mm02_00296579 predicted 709
4 SASI_Mm02_00296580 predicted 3245
5 SASI_Mm02_00296581 predicted 567
6 SASI_Mm02_00296582 predicted 3978
7 SASI_Mm02_00296583 predicted 3715
8 SASI_Mm02_00296584 predicted 1677
9 SASI_Mm02_00296585 predicted 1323
10 SASI_Mm02_00296586 predicted 3801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225915 predicted 1172
2 SASI_Mm01_00225916 predicted 2158
3 SASI_Mm01_00225917 predicted 718
4 SASI_Mm01_00225918 predicted 3249
5 SASI_Mm01_00225919 predicted 580
6 SASI_Mm01_00225920 predicted 3986
7 SASI_Mm01_00225921 predicted 3712
8 SASI_Mm01_00225922 predicted 1682
9 SASI_Mm01_00225923 predicted 1322
10 SASI_Mm01_00225924 predicted 3804
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260582 predicted 868
2 SASI_Mm01_00260583 predicted 1856
3 SASI_Mm01_00260584 predicted 407
4 SASI_Mm01_00260585 predicted 2951
5 SASI_Mm01_00260586 predicted 266
6 SASI_Mm01_00260587 predicted 3675
7 SASI_Mm01_00260588 predicted 3410
8 SASI_Mm01_00260589 predicted 1381
9 SASI_Mm01_00260590 predicted 1019
10 SASI_Mm01_00260591 predicted 3504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015687
FILIP1 MISSION shRNA Bacterial Glycerol Stock
filamin A interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-300s1c1
Sequence:CCGGCCACATGCTGAAGACAGAGAACTCGAGTTCTCTGTCTTCAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-2320s1c1
Sequence:CCGGCTGACCAAAGAGTTGGAGCTTCTCGAGAAGCTCCAACTCTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-3154s1c1
Sequence:CCGGGTACGGAAATACAACTCCAATCTCGAGATTGGAGTTGTATTTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-430s1c1
Sequence:CCGGGATGTCTATGAGAAACCGATTCTCGAGAATCGGTTTCTCATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-1266s1c1
Sequence:CCGGGCTCAGACTTGAAGTTGAGAACTCGAGTTCTCAACTTCAAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015687.1-753s1c1
Sequence:CCGGGCTGGTGGATGAAAGACAAATCTCGAGATTTGTCTTTCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015687.2-2557s21c1
Sequence:CCGGAGAGAAGATTCACGAATTAATCTCGAGATTAATTCGTGAATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4046s21c1
Sequence:CCGGATGCTACTGCTGCCGTGAAAGCTCGAGCTTTCACGGCAGCAGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4385s21c1
Sequence:CCGGTGTACCTTGTTCCACAATAATCTCGAGATTATTGTGGAACAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015687
FILIP1 MISSION shRNA shRNA Plasmid DNA
filamin A interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-300s1c1
Sequence:CCGGCCACATGCTGAAGACAGAGAACTCGAGTTCTCTGTCTTCAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-2320s1c1
Sequence:CCGGCTGACCAAAGAGTTGGAGCTTCTCGAGAAGCTCCAACTCTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-3154s1c1
Sequence:CCGGGTACGGAAATACAACTCCAATCTCGAGATTGGAGTTGTATTTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-430s1c1
Sequence:CCGGGATGTCTATGAGAAACCGATTCTCGAGAATCGGTTTCTCATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-1266s1c1
Sequence:CCGGGCTCAGACTTGAAGTTGAGAACTCGAGTTCTCAACTTCAAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015687.1-753s1c1
Sequence:CCGGGCTGGTGGATGAAAGACAAATCTCGAGATTTGTCTTTCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015687.2-2557s21c1
Sequence:CCGGAGAGAAGATTCACGAATTAATCTCGAGATTAATTCGTGAATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4046s21c1
Sequence:CCGGATGCTACTGCTGCCGTGAAAGCTCGAGCTTTCACGGCAGCAGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4385s21c1
Sequence:CCGGTGTACCTTGTTCCACAATAATCTCGAGATTATTGTGGAACAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015687
FILIP1 MISSION shRNA Lentiviral Transduction Particles
filamin A interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-300s1c1
Sequence:CCGGCCACATGCTGAAGACAGAGAACTCGAGTTCTCTGTCTTCAGCATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-2320s1c1
Sequence:CCGGCTGACCAAAGAGTTGGAGCTTCTCGAGAAGCTCCAACTCTTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-3154s1c1
Sequence:CCGGGTACGGAAATACAACTCCAATCTCGAGATTGGAGTTGTATTTCCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-430s1c1
Sequence:CCGGGATGTCTATGAGAAACCGATTCTCGAGAATCGGTTTCTCATAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015687.1-1266s1c1
Sequence:CCGGGCTCAGACTTGAAGTTGAGAACTCGAGTTCTCAACTTCAAGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015687.1-753s1c1
Sequence:CCGGGCTGGTGGATGAAAGACAAATCTCGAGATTTGTCTTTCATCCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015687.2-2557s21c1
Sequence:CCGGAGAGAAGATTCACGAATTAATCTCGAGATTAATTCGTGAATCTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4046s21c1
Sequence:CCGGATGCTACTGCTGCCGTGAAAGCTCGAGCTTTCACGGCAGCAGTAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015687.2-4385s21c1
Sequence:CCGGTGTACCTTGTTCCACAATAATCTCGAGATTATTGTGGAACAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081243
FILIP1 MISSION shRNA Bacterial Glycerol Stock
filamin A interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-2439s21c1
Sequence:CCGGCCGAGCAGGATAAGGCAAATTCTCGAGAATTTGCCTTATCCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3589s21c1
Sequence:CCGGGTACAATGCCAATGCGAATATCTCGAGATATTCGCATTGGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3789s21c1
Sequence:CCGGCAAGACCTGGTGCTAACAAAGCTCGAGCTTTGTTAGCACCAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-758s21c1
Sequence:CCGGGAGGTTCTGGAGGCGCATTATCTCGAGATAATGCGCCTCCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3277s21c1
Sequence:CCGGGAAACCACGGATCACCATAATCTCGAGATTATGGTGATCCGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081243
FILIP1 MISSION shRNA shRNA Plasmid DNA
filamin A interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-2439s21c1
Sequence:CCGGCCGAGCAGGATAAGGCAAATTCTCGAGAATTTGCCTTATCCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3589s21c1
Sequence:CCGGGTACAATGCCAATGCGAATATCTCGAGATATTCGCATTGGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3789s21c1
Sequence:CCGGCAAGACCTGGTGCTAACAAAGCTCGAGCTTTGTTAGCACCAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-758s21c1
Sequence:CCGGGAGGTTCTGGAGGCGCATTATCTCGAGATAATGCGCCTCCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3277s21c1
Sequence:CCGGGAAACCACGGATCACCATAATCTCGAGATTATGGTGATCCGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081243
FILIP1 MISSION shRNA Lentiviral Transduction Particles
filamin A interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-2439s21c1
Sequence:CCGGCCGAGCAGGATAAGGCAAATTCTCGAGAATTTGCCTTATCCTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3589s21c1
Sequence:CCGGGTACAATGCCAATGCGAATATCTCGAGATATTCGCATTGGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3789s21c1
Sequence:CCGGCAAGACCTGGTGCTAACAAAGCTCGAGCTTTGTTAGCACCAGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-758s21c1
Sequence:CCGGGAGGTTCTGGAGGCGCATTATCTCGAGATAATGCGCCTCCAGAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081243.1-3277s21c1
Sequence:CCGGGAAACCACGGATCACCATAATCTCGAGATTATGGTGATCCGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks