EMAIL THIS PAGE TO A FRIEND

FILIP1L

filamin A interacting protein 1-like

Synonyms: DOC-1 DOC1 GIP130 GIP130a GIP130b GIP130c GIP90
Gene ID:
Mouse(78749) filamin A interacting protein 1-like
Rat(304020) filamin A interacting protein 1-like
chicken(769163) filamin A interacting protein 1-like
cow(504954) filamin A interacting protein 1-like
Horse(100034033) filamin A interacting protein 1-like
domestic cat(101092134) filamin A interacting protein 1-like
dog(478537) filamin A interacting protein 1-like
sheep(101107834) filamin A interacting protein 1-like
Domestic Rabbit(100338168) filamin A interacting protein 1-like
naked mole-rat(101710264) filamin A interacting protein 1-like
domestic guinea pig(100718394) filamin A interacting protein 1-like
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014890 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014890 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014890 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042459 Rosetta Predictions human pricing
NM_014890 Rosetta Predictions human pricing
NM_182909 Rosetta Predictions human pricing
XM_001056823 Rosetta Predictions rat pricing
XM_221535 Rosetta Predictions rat pricing
NM_001040397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309888 predicted 3597
2 SASI_Hs02_00309889 predicted 2980
3 SASI_Hs02_00309890 predicted 1817
4 SASI_Hs02_00309891 predicted 2341
5 SASI_Hs02_00309892 predicted 2193
6 SASI_Hs02_00309893 predicted 2431
7 SASI_Hs02_00309894 predicted 3378
8 SASI_Hs02_00309895 predicted 1874
9 SASI_Hs02_00309896 predicted 3168
10 SASI_Hs02_00309897 predicted 2968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346517 predicted 2656
2 SASI_Hs01_00218751 predicted 2048
3 SASI_Hs02_00346518 predicted 886
4 SASI_Hs01_00218754 predicted 1409
5 SASI_Hs01_00218755 predicted 1248
6 SASI_Hs01_00218756 predicted 1495
7 SASI_Hs02_00346519 predicted 2440
8 SASI_Hs01_00218757 predicted 945
9 SASI_Hs01_00218759 predicted 2237
10 SASI_Hs01_00218760 predicted 2034
11 SASI_Hs01_00218752 predicted 2045
12 SASI_Hs01_00218753 predicted 831
13 SASI_Hs01_00218758 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371012 predicted 3589
2 SASI_Hs02_00371013 predicted 2978
3 SASI_Hs02_00371014 predicted 1816
4 SASI_Hs01_00019544 predicted 2346
5 SASI_Hs01_00019546 predicted 2194
6 SASI_Hs01_00019547 predicted 2433
7 SASI_Hs02_00371015 predicted 3386
8 SASI_Hs01_00019548 predicted 1882
9 SASI_Hs02_00371016 predicted 3172
10 SASI_Hs02_00371017 predicted 2972
11 SASI_Hs01_00019542 predicted 2088
12 SASI_Hs01_00019543 predicted 1931
13 SASI_Hs01_00019545 predicted 2305
14 SASI_Hs01_00019549 predicted 2067
15 SASI_Hs01_00019550 predicted 1283
16 SASI_Hs01_00019551 predicted 2220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284550 predicted 2043
2 SASI_Rn02_00284551 predicted 3353
3 SASI_Rn02_00284552 predicted 411
4 SASI_Rn02_00284553 predicted 1443
5 SASI_Rn02_00284554 predicted 1227
6 SASI_Rn02_00284555 predicted 2841
7 SASI_Rn02_00284556 predicted 3259
8 SASI_Rn02_00284557 predicted 983
9 SASI_Rn02_00284558 predicted 1395
10 SASI_Rn02_00284559 predicted 2451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380211 predicted 3142
2 SASI_Rn02_00380212 predicted 3353
3 SASI_Rn02_00380213 predicted 411
4 SASI_Rn02_00380214 predicted 1447
5 SASI_Rn02_00380215 predicted 1225
6 SASI_Rn02_00380216 predicted 788
7 SASI_Rn02_00380217 predicted 3252
8 SASI_Rn02_00380218 predicted 985
9 SASI_Rn02_00380219 predicted 1404
10 SASI_Rn02_00380220 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070858 predicted 601
2 SASI_Mm01_00070859 predicted 750
3 SASI_Mm01_00070860 predicted 852
4 SASI_Mm01_00070861 predicted 822
5 SASI_Mm01_00070862 predicted 388
6 SASI_Mm01_00070863 predicted 268
7 SASI_Mm01_00070864 predicted 383
8 SASI_Mm01_00070865 predicted 383
9 SASI_Mm01_00070866 predicted 608
10 SASI_Mm01_00070867 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014890
FILIP1L MISSION shRNA Bacterial Glycerol Stock
filamin A interacting protein 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014890.2-2943s21c1
Sequence:CCGGATCCAGTCCATACTGATATTTCTCGAGAAATATCAGTATGGACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-1714s21c1
Sequence:CCGGATGGCAACTGAAGACCTAATACTCGAGTATTAGGTCTTCAGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-2601s21c1
Sequence:CCGGCAGTGCCAAGCATGCGATATTCTCGAGAATATCGCATGCTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1833s1c1
Sequence:CCGGGCAGTCATCAATGGTCAGTTACTCGAGTAACTGACCATTGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-793s1c1
Sequence:CCGGCCATTGAAAGTCGGCTAGAAACTCGAGTTTCTAGCCGACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014890.1-2664s1c1
Sequence:CCGGCCAATAAAGTCACCAGCAGTACTCGAGTACTGCTGGTGACTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1145s1c1
Sequence:CCGGGCTTCAATCATTGGAAGCAATCTCGAGATTGCTTCCAATGATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014890.1-2517s1c1
Sequence:CCGGGCAATAGCTCAAGTGTGATAACTCGAGTTATCACACTTGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1425s1c1
Sequence:CCGGGCTAAGTACAAGTTAGCAGAACTCGAGTTCTGCTAACTTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014890
FILIP1L MISSION shRNA shRNA Plasmid DNA
filamin A interacting protein 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014890.2-2943s21c1
Sequence:CCGGATCCAGTCCATACTGATATTTCTCGAGAAATATCAGTATGGACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-1714s21c1
Sequence:CCGGATGGCAACTGAAGACCTAATACTCGAGTATTAGGTCTTCAGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-2601s21c1
Sequence:CCGGCAGTGCCAAGCATGCGATATTCTCGAGAATATCGCATGCTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1833s1c1
Sequence:CCGGGCAGTCATCAATGGTCAGTTACTCGAGTAACTGACCATTGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-793s1c1
Sequence:CCGGCCATTGAAAGTCGGCTAGAAACTCGAGTTTCTAGCCGACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014890.1-2664s1c1
Sequence:CCGGCCAATAAAGTCACCAGCAGTACTCGAGTACTGCTGGTGACTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1145s1c1
Sequence:CCGGGCTTCAATCATTGGAAGCAATCTCGAGATTGCTTCCAATGATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014890.1-2517s1c1
Sequence:CCGGGCAATAGCTCAAGTGTGATAACTCGAGTTATCACACTTGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1425s1c1
Sequence:CCGGGCTAAGTACAAGTTAGCAGAACTCGAGTTCTGCTAACTTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014890
FILIP1L MISSION shRNA Lentiviral Transduction Particles
filamin A interacting protein 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014890.2-2943s21c1
Sequence:CCGGATCCAGTCCATACTGATATTTCTCGAGAAATATCAGTATGGACTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-1714s21c1
Sequence:CCGGATGGCAACTGAAGACCTAATACTCGAGTATTAGGTCTTCAGTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014890.2-2601s21c1
Sequence:CCGGCAGTGCCAAGCATGCGATATTCTCGAGAATATCGCATGCTTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1833s1c1
Sequence:CCGGGCAGTCATCAATGGTCAGTTACTCGAGTAACTGACCATTGATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-793s1c1
Sequence:CCGGCCATTGAAAGTCGGCTAGAAACTCGAGTTTCTAGCCGACTTTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014890.1-2664s1c1
Sequence:CCGGCCAATAAAGTCACCAGCAGTACTCGAGTACTGCTGGTGACTTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1145s1c1
Sequence:CCGGGCTTCAATCATTGGAAGCAATCTCGAGATTGCTTCCAATGATTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136171    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014890.1-2517s1c1
Sequence:CCGGGCAATAGCTCAAGTGTGATAACTCGAGTTATCACACTTGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014890.1-1425s1c1
Sequence:CCGGGCTAAGTACAAGTTAGCAGAACTCGAGTTCTGCTAACTTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030163
VALIDATED
FILIP1L MISSION shRNA Bacterial Glycerol Stock
filamin A interacting protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3721s21c1
Sequence:CCGGGAGTATCTGGAACTAACTATGCTCGAGCATAGTTAGTTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-1168s21c1
Sequence:CCGGGCAGCACTCAGTCGGCAAATTCTCGAGAATTTGCCGACTGAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-387s21c1
Sequence:CCGGCTCAAGAGATGACTTACTATTCTCGAGAATAGTAAGTCATCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3347s21c1
Sequence:CCGGTGATAACTACTGAGGATAATACTCGAGTATTATCCTCAGTAGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-2375s21c1
Sequence:CCGGTGGCCACAGAGGACCTAATATCTCGAGATATTAGGTCCTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030163
VALIDATED
FILIP1L MISSION shRNA shRNA Plasmid DNA
filamin A interacting protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3721s21c1
Sequence:CCGGGAGTATCTGGAACTAACTATGCTCGAGCATAGTTAGTTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-1168s21c1
Sequence:CCGGGCAGCACTCAGTCGGCAAATTCTCGAGAATTTGCCGACTGAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-387s21c1
Sequence:CCGGCTCAAGAGATGACTTACTATTCTCGAGAATAGTAAGTCATCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3347s21c1
Sequence:CCGGTGATAACTACTGAGGATAATACTCGAGTATTATCCTCAGTAGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-2375s21c1
Sequence:CCGGTGGCCACAGAGGACCTAATATCTCGAGATATTAGGTCCTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030163
VALIDATED
FILIP1L MISSION shRNA Lentiviral Transduction Particles
filamin A interacting protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3721s21c1
Sequence:CCGGGAGTATCTGGAACTAACTATGCTCGAGCATAGTTAGTTCCAGATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-1168s21c1
Sequence:CCGGGCAGCACTCAGTCGGCAAATTCTCGAGAATTTGCCGACTGAGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-387s21c1
Sequence:CCGGCTCAAGAGATGACTTACTATTCTCGAGAATAGTAAGTCATCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030163.1-3347s21c1
Sequence:CCGGTGATAACTACTGAGGATAATACTCGAGTATTATCCTCAGTAGTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030163.1-2375s21c1
Sequence:CCGGTGGCCACAGAGGACCTAATATCTCGAGATATTAGGTCCTCTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks