EMAIL THIS PAGE TO A FRIEND

FIP1L1

factor interacting with PAPOLA and CPSF1

65 Gene Product Result for
Synonyms: FIP1 Rhe hFip1
Gene ID:
Human(81608) Summary: This gene encodes a subunit of the CPSF (cleavage and polyadenylation specificity factor) complex that polyadenylates the 3' end of mRNA precursors. This gene, the homolog of yeast Fip1 (factor interacting with PAP), binds to U-rich sequences of pre-mRNA and stimulates poly(A) polymerase activity. Its N-terminus contains a PAP-binding site and its C-terminus an RNA-binding domain. An interstitial chromosomal deletion on 4q12 creates an in-frame fusion of human genes FIP1L1 and PDGFRA (platelet-derived growth factor receptor, alpha). The FIP1L1-PDGFRA fusion gene encodes a constitutively activated tyrosine kinase that joins the first 233 amino acids of FIP1L1 to the last 523 amino acids of PDGFRA. This gene fusion and chromosomal deletion is the cause of some forms of idiopathic hypereosinophilic syndrome (HES). This syndrome, recently reclassified as chronic eosinophilic leukemia (CEL), is responsive to treatment with tyrosine kinase inhibitors. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Mouse(66899) FIP1 like 1 (S. cerevisiae)
Rat(289582) factor interacting with PAPOLA and CPSF1
chicken(422754) FIP1 like 1 (S. cerevisiae)
domestic cat(101092180) FIP1 like 1 (S. cerevisiae)
cow(100138550) FIP1 like 1 (S. cerevisiae)
Horse(100060154) FIP1 like 1 (S. cerevisiae)
dog(612980) FIP1 like 1 (S. cerevisiae)
sheep(101115126) FIP1 like 1 (S. cerevisiae)
Domestic Rabbit(100341056) FIP1 like 1 (S. cerevisiae)
domestic guinea pig(100725850) factor interacting with PAPOLA and CPSF1
naked mole-rat(101700547) FIP1 like 1 (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030917 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030917 Rosetta Predictions human pricing
NM_001008295 Rosetta Predictions rat pricing
NM_024183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192134 predicted 726
2 SASI_Hs01_00192135 predicted 981
3 SASI_Hs02_00358458 predicted 1901
4 SASI_Hs01_00192137 predicted 691
5 SASI_Hs02_00358459 predicted 745
6 SASI_Hs01_00192139 predicted 716
7 SASI_Hs01_00192140 predicted 720
8 SASI_Hs01_00192141 predicted 906
9 SASI_Hs02_00358460 predicted 1804
10 SASI_Hs02_00358461 predicted 1807
11 SASI_Hs01_00192136 predicted 854
12 SASI_Hs01_00192138 predicted 782
13 SASI_Hs01_00192142 predicted 816
14 SASI_Hs01_00192143 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105423 predicted 704
2 SASI_Rn02_00198999 predicted 239
3 SASI_Rn01_00105424 predicted 230
4 SASI_Rn01_00105425 predicted 217
5 SASI_Rn01_00105427 predicted 294
6 SASI_Rn01_00105428 predicted 395
7 SASI_Rn01_00105429 predicted 615
8 SASI_Rn01_00105430 predicted 736
9 SASI_Rn01_00105431 predicted 553
10 SASI_Rn01_00105432 predicted 467
11 SASI_Rn01_00105426 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112484 predicted 594
2 SASI_Mm01_00112485 predicted 555
3 SASI_Mm01_00112486 predicted 328
4 SASI_Mm01_00112487 predicted 483
5 SASI_Mm01_00112489 predicted 657
6 SASI_Mm02_00327504 predicted 509
7 SASI_Mm01_00112491 predicted 1838
8 SASI_Mm01_00112492 predicted 775
9 SASI_Mm02_00327505 predicted 1635
10 SASI_Mm02_00327506 predicted 738
11 SASI_Mm01_00112488 predicted 858
12 SASI_Mm01_00112490 predicted 1142
13 SASI_Mm01_00112493 predicted 514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024183
FIP1L1 MISSION shRNA Bacterial Glycerol Stock
factor interacting with PAPOLA and CPSF1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024183.3-2767s1c1
Sequence:CCGGGCCCATAATATACTCTGTCTTCTCGAGAAGACAGAGTATATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1668s1c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1218s1c1
Sequence:CCGGCCATCTCTTATACCAACAATACTCGAGTATTGTTGGTATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1024s1c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-978s1c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1055s21c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1699s21c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1009s21c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024183.5-2325s21c1
Sequence:CCGGTAGTAACTAAGTGGACTATTTCTCGAGAAATAGTCCACTTAGTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1387s21c1
Sequence:CCGGACCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024183
FIP1L1 MISSION shRNA shRNA Plasmid DNA
factor interacting with PAPOLA and CPSF1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024183.3-2767s1c1
Sequence:CCGGGCCCATAATATACTCTGTCTTCTCGAGAAGACAGAGTATATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1668s1c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1218s1c1
Sequence:CCGGCCATCTCTTATACCAACAATACTCGAGTATTGTTGGTATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1024s1c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-978s1c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1055s21c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1699s21c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1009s21c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024183.5-2325s21c1
Sequence:CCGGTAGTAACTAAGTGGACTATTTCTCGAGAAATAGTCCACTTAGTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1387s21c1
Sequence:CCGGACCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024183
FIP1L1 MISSION shRNA Lentiviral Transduction Particles
factor interacting with PAPOLA and CPSF1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024183.3-2767s1c1
Sequence:CCGGGCCCATAATATACTCTGTCTTCTCGAGAAGACAGAGTATATTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1668s1c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1218s1c1
Sequence:CCGGCCATCTCTTATACCAACAATACTCGAGTATTGTTGGTATAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-1024s1c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024183.3-978s1c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1055s21c1
Sequence:CCGGCCACTGAAGTAGACAACAATTCTCGAGAATTGTTGTCTACTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1699s21c1
Sequence:CCGGCGTCGCCATGAAAGTGAAGAACTCGAGTTCTTCACTTTCATGGCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1009s21c1
Sequence:CCGGCGTGCAAATGAGAACAGCAATCTCGAGATTGCTGTTCTCATTTGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305533    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024183.5-2325s21c1
Sequence:CCGGTAGTAACTAAGTGGACTATTTCTCGAGAAATAGTCCACTTAGTTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024183.5-1387s21c1
Sequence:CCGGACCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030917
VALIDATED
FIP1L1 MISSION shRNA Bacterial Glycerol Stock
factor interacting with PAPOLA and CPSF1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1957s1c1
Sequence:CCGGGTACCAGAAGTAGATACTATACTCGAGTATAGTATCTACTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1643s1c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1759s1c1
Sequence:CCGGCCAGACATAAGTCTTCTCGAACTCGAGTTCGAGAAGACTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1381s1c1
Sequence:CCGGCCTCTGGTTATGATAGTCGTTCTCGAGAACGACTATCATAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-729s1c1
Sequence:CCGGCGAATGGGACTTGAAGTTATACTCGAGTATAACTTCAAGTCCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-1528s21c1
Sequence:CCGGAGCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1129s21c1
Sequence:CCGGGATGTTATCGGTCAGACTATACTCGAGTATAGTCTGACCGATAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1686s21c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-2216s21c1
Sequence:CCGGTCACTTAACAGGGAATCTAAACTCGAGTTTAGATTCCCTGTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1089s21c1
Sequence:CCGGGGCCGAATCACCTGATCTAAGCTCGAGCTTAGATCAGGTGATTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030917
VALIDATED
FIP1L1 MISSION shRNA shRNA Plasmid DNA
factor interacting with PAPOLA and CPSF1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1957s1c1
Sequence:CCGGGTACCAGAAGTAGATACTATACTCGAGTATAGTATCTACTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1643s1c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1759s1c1
Sequence:CCGGCCAGACATAAGTCTTCTCGAACTCGAGTTCGAGAAGACTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1381s1c1
Sequence:CCGGCCTCTGGTTATGATAGTCGTTCTCGAGAACGACTATCATAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-729s1c1
Sequence:CCGGCGAATGGGACTTGAAGTTATACTCGAGTATAACTTCAAGTCCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-1528s21c1
Sequence:CCGGAGCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1129s21c1
Sequence:CCGGGATGTTATCGGTCAGACTATACTCGAGTATAGTCTGACCGATAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1686s21c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-2216s21c1
Sequence:CCGGTCACTTAACAGGGAATCTAAACTCGAGTTTAGATTCCCTGTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1089s21c1
Sequence:CCGGGGCCGAATCACCTGATCTAAGCTCGAGCTTAGATCAGGTGATTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030917
VALIDATED
FIP1L1 MISSION shRNA Lentiviral Transduction Particles
factor interacting with PAPOLA and CPSF1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1957s1c1
Sequence:CCGGGTACCAGAAGTAGATACTATACTCGAGTATAGTATCTACTTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1643s1c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1759s1c1
Sequence:CCGGCCAGACATAAGTCTTCTCGAACTCGAGTTCGAGAAGACTTATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-1381s1c1
Sequence:CCGGCCTCTGGTTATGATAGTCGTTCTCGAGAACGACTATCATAACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_030917.2-729s1c1
Sequence:CCGGCGAATGGGACTTGAAGTTATACTCGAGTATAACTTCAAGTCCCATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-1528s21c1
Sequence:CCGGAGCAAGCAGTGGGACTATTATCTCGAGATAATAGTCCCACTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1129s21c1
Sequence:CCGGGATGTTATCGGTCAGACTATACTCGAGTATAGTCTGACCGATAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1686s21c1
Sequence:CCGGCGATGAAGAACGATACAGATACTCGAGTATCTGTATCGTTCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_030917.3-2216s21c1
Sequence:CCGGTCACTTAACAGGGAATCTAAACTCGAGTTTAGATTCCCTGTTAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030917.3-1089s21c1
Sequence:CCGGGGCCGAATCACCTGATCTAAGCTCGAGCTTAGATCAGGTGATTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks